about summary refs log tree commit diff
diff options
context:
space:
mode:
-rw-r--r--nixpkgs/CONTRIBUTING.md2
-rw-r--r--nixpkgs/doc/languages-frameworks/python.section.md1
-rw-r--r--nixpkgs/maintainers/maintainer-list.nix52
-rw-r--r--nixpkgs/maintainers/scripts/luarocks-packages.csv1
-rw-r--r--nixpkgs/nixos/doc/manual/release-notes/rl-2311.section.md4
-rw-r--r--nixpkgs/nixos/lib/test-driver/test_driver/machine.py22
-rw-r--r--nixpkgs/nixos/modules/misc/ids.nix4
-rw-r--r--nixpkgs/nixos/modules/module-list.nix2
-rw-r--r--nixpkgs/nixos/modules/programs/firefox.nix25
-rw-r--r--nixpkgs/nixos/modules/rename.nix1
-rw-r--r--nixpkgs/nixos/modules/services/games/asf.nix22
-rw-r--r--[-rwxr-xr-x]nixpkgs/nixos/modules/services/misc/confd.nix0
-rw-r--r--nixpkgs/nixos/modules/services/networking/ddclient.nix234
-rw-r--r--nixpkgs/nixos/modules/services/networking/networkmanager.nix93
-rw-r--r--nixpkgs/nixos/modules/services/security/fail2ban.nix6
-rw-r--r--nixpkgs/nixos/modules/services/security/jitterentropy-rngd.nix18
-rw-r--r--nixpkgs/nixos/modules/services/web-servers/nginx/default.nix4
-rw-r--r--nixpkgs/nixos/modules/services/web-servers/nginx/vhost-options.nix7
-rw-r--r--nixpkgs/nixos/modules/system/boot/systemd/initrd.nix2
-rw-r--r--nixpkgs/nixos/modules/tasks/filesystems/btrfs.nix17
-rw-r--r--nixpkgs/nixos/modules/tasks/filesystems/cifs.nix2
-rw-r--r--nixpkgs/nixos/modules/tasks/filesystems/ext.nix2
-rw-r--r--nixpkgs/nixos/modules/tasks/filesystems/f2fs.nix2
-rw-r--r--nixpkgs/nixos/modules/tasks/filesystems/jfs.nix2
-rw-r--r--nixpkgs/nixos/modules/tasks/filesystems/reiserfs.nix2
-rw-r--r--nixpkgs/nixos/modules/tasks/filesystems/vfat.nix2
-rw-r--r--nixpkgs/nixos/modules/tasks/filesystems/xfs.nix2
-rw-r--r--nixpkgs/nixos/modules/tasks/filesystems/zfs.nix10
-rw-r--r--nixpkgs/nixos/tests/all-tests.nix1
-rw-r--r--nixpkgs/nixos/tests/installer.nix3
-rw-r--r--nixpkgs/nixos/tests/nginx-unix-socket.nix27
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/applications/audio/soundwireserver/default.nix0
-rw-r--r--nixpkgs/pkgs/applications/blockchains/snarkos/default.nix6
-rw-r--r--nixpkgs/pkgs/applications/blockchains/trezor-suite/default.nix6
-rw-r--r--nixpkgs/pkgs/applications/editors/jetbrains/plugins/plugins.json97
-rw-r--r--nixpkgs/pkgs/applications/editors/jetbrains/versions.json96
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/applications/editors/neovim/neovim-gtk.nix0
-rw-r--r--nixpkgs/pkgs/applications/editors/pulsar/default.nix9
-rw-r--r--nixpkgs/pkgs/applications/editors/texmacs/default.nix42
-rw-r--r--nixpkgs/pkgs/applications/editors/vim/plugins/generated.nix12
-rw-r--r--nixpkgs/pkgs/applications/editors/vim/plugins/vim-plugin-names1
-rw-r--r--nixpkgs/pkgs/applications/editors/vscode/extensions/default.nix4
-rw-r--r--nixpkgs/pkgs/applications/emulators/yuzu/generic.nix4
-rw-r--r--nixpkgs/pkgs/applications/emulators/yuzu/sources.nix14
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/applications/graphics/structorizer/default.nix0
-rw-r--r--nixpkgs/pkgs/applications/misc/ArchiSteamFarm/default.nix5
-rw-r--r--nixpkgs/pkgs/applications/misc/ArchiSteamFarm/deps.nix21
-rwxr-xr-xnixpkgs/pkgs/applications/misc/ArchiSteamFarm/update.sh8
-rw-r--r--nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore1
-rw-r--r--nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix12
-rwxr-xr-xnixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh16
-rw-r--r--nixpkgs/pkgs/applications/misc/albert/default.nix2
-rw-r--r--nixpkgs/pkgs/applications/misc/blender/default.nix4
-rw-r--r--nixpkgs/pkgs/applications/misc/dasel/default.nix6
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/applications/misc/fluxboxlauncher/default.nix0
-rw-r--r--nixpkgs/pkgs/applications/misc/get_iplayer/default.nix6
-rw-r--r--nixpkgs/pkgs/applications/misc/nwg-displays/default.nix4
-rw-r--r--nixpkgs/pkgs/applications/misc/nwg-panel/default.nix4
-rw-r--r--nixpkgs/pkgs/applications/misc/obsidian/default.nix4
-rw-r--r--nixpkgs/pkgs/applications/networking/browsers/brave/default.nix4
-rw-r--r--nixpkgs/pkgs/applications/networking/browsers/chromium/common.nix6
-rw-r--r--nixpkgs/pkgs/applications/networking/cluster/eks-node-viewer/default.nix6
-rw-r--r--nixpkgs/pkgs/applications/networking/cluster/flink/default.nix2
-rw-r--r--nixpkgs/pkgs/applications/networking/cluster/terraform-providers/providers.json8
-rw-r--r--nixpkgs/pkgs/applications/networking/cluster/terragrunt/default.nix6
-rw-r--r--nixpkgs/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix8
-rw-r--r--nixpkgs/pkgs/applications/networking/instant-messengers/teams-for-linux/default.nix6
-rw-r--r--nixpkgs/pkgs/applications/networking/p2p/tremotesf/default.nix4
-rw-r--r--nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix52
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/applications/science/biology/poretools/default.nix0
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/applications/science/biology/trimal/default.nix0
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/applications/science/biology/vcftools/default.nix0
-rw-r--r--nixpkgs/pkgs/applications/science/misc/root/default.nix4
-rw-r--r--nixpkgs/pkgs/applications/video/kodi/addons/inputstream-adaptive/default.nix4
-rw-r--r--nixpkgs/pkgs/applications/video/kodi/addons/netflix/default.nix6
-rw-r--r--nixpkgs/pkgs/applications/video/kodi/addons/youtube/default.nix15
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/applications/virtualization/vmware-workstation/default.nix0
-rw-r--r--nixpkgs/pkgs/build-support/fetchdocker/credentials.nix1
-rw-r--r--nixpkgs/pkgs/build-support/fetchdocker/generic-fetcher.nix2
-rw-r--r--nixpkgs/pkgs/build-support/kernel/make-initrd-ng/src/main.rs2
-rw-r--r--nixpkgs/pkgs/by-name/al/alpine-make-rootfs/package.nix33
-rw-r--r--nixpkgs/pkgs/by-name/ar/argagg/package.nix (renamed from nixpkgs/pkgs/development/libraries/argagg/default.nix)25
-rw-r--r--nixpkgs/pkgs/by-name/ar/argtable/package.nix (renamed from nixpkgs/pkgs/development/libraries/argtable/default.nix)22
-rw-r--r--nixpkgs/pkgs/by-name/ba/bashly/Gemfile2
-rw-r--r--nixpkgs/pkgs/by-name/ba/bashly/Gemfile.lock59
-rw-r--r--nixpkgs/pkgs/by-name/ba/bashly/gemset.nix231
-rw-r--r--nixpkgs/pkgs/by-name/ba/bashly/package.nix38
-rw-r--r--nixpkgs/pkgs/by-name/fi/firewalk/package.nix27
-rw-r--r--nixpkgs/pkgs/by-name/fl/flip/package.nix32
-rw-r--r--nixpkgs/pkgs/by-name/hi/hifile/package.nix41
-rw-r--r--nixpkgs/pkgs/by-name/ji/jitterentropy-rngd/package.nix34
-rw-r--r--nixpkgs/pkgs/by-name/on/onedriver/package.nix64
-rw-r--r--nixpkgs/pkgs/by-name/pr/presenterm/package.nix8
-rw-r--r--nixpkgs/pkgs/by-name/te/tecoc/package.nix (renamed from nixpkgs/pkgs/applications/editors/tecoc/default.nix)2
-rw-r--r--nixpkgs/pkgs/by-name/tp/tpm2-totp/package.nix46
-rw-r--r--nixpkgs/pkgs/by-name/tr/trealla/package.nix4
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/data/fonts/vazir-fonts/default.nix0
-rw-r--r--nixpkgs/pkgs/data/themes/nordic/default.nix10
-rw-r--r--nixpkgs/pkgs/data/themes/orchis-theme/default.nix4
-rw-r--r--nixpkgs/pkgs/development/compilers/flix/default.nix4
-rw-r--r--nixpkgs/pkgs/development/compilers/mrustc/default.nix6
-rw-r--r--nixpkgs/pkgs/development/libraries/argagg/0001-catch.diff20
-rw-r--r--nixpkgs/pkgs/development/libraries/duckdb/default.nix10
-rw-r--r--nixpkgs/pkgs/development/libraries/duckdb/version.patch22
-rw-r--r--nixpkgs/pkgs/development/libraries/ldb/default.nix4
-rw-r--r--nixpkgs/pkgs/development/libraries/libspf2/default.nix18
-rw-r--r--nixpkgs/pkgs/development/libraries/libunarr/default.nix4
-rw-r--r--nixpkgs/pkgs/development/libraries/openxr-loader/default.nix4
-rw-r--r--nixpkgs/pkgs/development/libraries/science/chemistry/tblite/default.nix9
-rw-r--r--nixpkgs/pkgs/development/libraries/toml-f/default.nix4
-rw-r--r--nixpkgs/pkgs/development/libraries/virglrenderer/default.nix12
-rw-r--r--nixpkgs/pkgs/development/libraries/zlib-ng/default.nix4
-rw-r--r--nixpkgs/pkgs/development/lua-modules/generated-packages.nix24
-rw-r--r--nixpkgs/pkgs/development/node-packages/node-packages.json1
-rw-r--r--nixpkgs/pkgs/development/node-packages/node-packages.nix359
-rw-r--r--nixpkgs/pkgs/development/php-packages/opentelemetry/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/aioairzone-cloud/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/aioairzone/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/aioelectricitymaps/default.nix55
-rw-r--r--nixpkgs/pkgs/development/python-modules/aioesphomeapi/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/async-upnp-client/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/asyncwhois/default.nix4
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/development/python-modules/atlassian-python-api/default.nix0
-rw-r--r--nixpkgs/pkgs/development/python-modules/bimmer-connected/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/bleak/default.nix12
-rw-r--r--nixpkgs/pkgs/development/python-modules/cantools/default.nix58
-rw-r--r--nixpkgs/pkgs/development/python-modules/certbot-dns-ovh/default.nix39
-rw-r--r--nixpkgs/pkgs/development/python-modules/dbus-fast/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/duckdb/default.nix16
-rw-r--r--nixpkgs/pkgs/development/python-modules/duckdb/setup.patch30
-rw-r--r--nixpkgs/pkgs/development/python-modules/elgato/default.nix21
-rw-r--r--nixpkgs/pkgs/development/python-modules/fypp/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/gpaw/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/guppy3/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/moddb/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/num2words/default.nix4
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/development/python-modules/osmnx/default.nix0
-rw-r--r--nixpkgs/pkgs/development/python-modules/peaqevcore/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/persim/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/plugwise/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/pvo/default.nix20
-rw-r--r--nixpkgs/pkgs/development/python-modules/pyduotecno/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/pyenphase/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/pyliblo/default.nix11
-rw-r--r--nixpkgs/pkgs/development/python-modules/pyrate-limiter/default.nix6
-rw-r--r--nixpkgs/pkgs/development/python-modules/pyscf/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/python-myq/default.nix (renamed from nixpkgs/pkgs/development/python-modules/pymyq/default.nix)2
-rw-r--r--nixpkgs/pkgs/development/python-modules/readmdict/default.nix50
-rw-r--r--nixpkgs/pkgs/development/python-modules/sensor-state-data/default.nix4
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/development/python-modules/streamlit/default.nix0
-rw-r--r--nixpkgs/pkgs/development/python-modules/textparser/default.nix39
-rw-r--r--nixpkgs/pkgs/development/python-modules/toonapi/default.nix16
-rw-r--r--nixpkgs/pkgs/development/python-modules/trezor/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/twentemilieu/default.nix12
-rw-r--r--nixpkgs/pkgs/development/python-modules/vehicle/default.nix6
-rw-r--r--nixpkgs/pkgs/development/python-modules/velbus-aio/default.nix4
-rw-r--r--nixpkgs/pkgs/development/python-modules/wallbox/default.nix4
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/development/python-modules/zstandard/default.nix0
-rw-r--r--nixpkgs/pkgs/development/tools/analysis/checkov/default.nix4
-rw-r--r--nixpkgs/pkgs/development/tools/analysis/rizin/default.nix4
-rw-r--r--nixpkgs/pkgs/development/tools/clj-kondo/default.nix4
-rw-r--r--nixpkgs/pkgs/development/tools/database/timescaledb-tune/default.nix4
-rw-r--r--nixpkgs/pkgs/development/tools/electron/binary/generic.nix2
-rw-r--r--nixpkgs/pkgs/development/tools/java/dex2jar/default.nix6
-rw-r--r--nixpkgs/pkgs/development/tools/misc/texlab/default.nix8
-rw-r--r--nixpkgs/pkgs/development/tools/poetry2nix/poetry2nix/overrides/build-systems.json3
-rw-r--r--nixpkgs/pkgs/development/tools/railway/default.nix6
-rw-r--r--nixpkgs/pkgs/development/tools/rust/cargo-codspeed/default.nix6
-rw-r--r--nixpkgs/pkgs/development/web/minify/default.nix6
-rw-r--r--nixpkgs/pkgs/games/openra/build-engine.nix2
-rw-r--r--nixpkgs/pkgs/games/starsector/default.nix8
-rw-r--r--nixpkgs/pkgs/games/steam/fhsenv.nix15
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/misc/uq/default.nix0
-rw-r--r--nixpkgs/pkgs/os-specific/linux/kernel/zen-kernels.nix10
-rw-r--r--nixpkgs/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix4
-rw-r--r--nixpkgs/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix3
-rw-r--r--nixpkgs/pkgs/os-specific/linux/oci-seccomp-bpf-hook/default.nix4
-rw-r--r--nixpkgs/pkgs/servers/home-assistant/component-packages.nix6
-rw-r--r--nixpkgs/pkgs/servers/home-assistant/default.nix6
-rw-r--r--nixpkgs/pkgs/servers/home-assistant/stubs.nix4
-rw-r--r--nixpkgs/pkgs/servers/http/apache-httpd/2.4.nix4
-rw-r--r--nixpkgs/pkgs/servers/http/lighttpd/default.nix15
-rw-r--r--nixpkgs/pkgs/servers/http/lighttpd/disable-legacy-crypt-tests.patch35
-rw-r--r--nixpkgs/pkgs/servers/http/nginx/generic.nix2
-rw-r--r--nixpkgs/pkgs/servers/http/tomcat/tomcat-native.nix4
-rw-r--r--nixpkgs/pkgs/servers/monitoring/librenms/default.nix1
-rw-r--r--nixpkgs/pkgs/servers/samba/4.x.nix4
-rw-r--r--nixpkgs/pkgs/servers/teleport/11/default.nix4
-rw-r--r--nixpkgs/pkgs/servers/teleport/12/Cargo.lock4
-rw-r--r--nixpkgs/pkgs/servers/teleport/12/default.nix8
-rw-r--r--nixpkgs/pkgs/servers/teleport/13/Cargo.lock4
-rw-r--r--nixpkgs/pkgs/servers/teleport/13/default.nix8
-rw-r--r--nixpkgs/pkgs/servers/teleport/14/Cargo.lock4
-rw-r--r--nixpkgs/pkgs/servers/teleport/14/default.nix8
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/servers/unifi-video/default.nix0
-rw-r--r--nixpkgs/pkgs/stdenv/linux/default.nix2
-rw-r--r--nixpkgs/pkgs/tools/X11/xssstate/default.nix24
-rw-r--r--nixpkgs/pkgs/tools/admin/syft/default.nix6
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/tools/archivers/payload-dumper-go/default.nix0
-rw-r--r--nixpkgs/pkgs/tools/filesystems/erofs-utils/default.nix1
-rw-r--r--nixpkgs/pkgs/tools/inputmethods/evsieve/default.nix31
-rw-r--r--nixpkgs/pkgs/tools/misc/ckb-next/default.nix12
-rw-r--r--nixpkgs/pkgs/tools/misc/codebraid/default.nix8
-rw-r--r--nixpkgs/pkgs/tools/misc/esphome/default.nix4
-rw-r--r--nixpkgs/pkgs/tools/misc/fd/default.nix6
-rw-r--r--nixpkgs/pkgs/tools/misc/lazydocker/default.nix4
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/tools/misc/starfetch/default.nix0
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/tools/misc/szyszka/default.nix0
-rw-r--r--nixpkgs/pkgs/tools/misc/timer/default.nix6
-rw-r--r--nixpkgs/pkgs/tools/misc/topgrade/default.nix6
-rw-r--r--nixpkgs/pkgs/tools/networking/ddclient/default.nix53
-rw-r--r--nixpkgs/pkgs/tools/networking/globalping-cli/default.nix4
-rw-r--r--nixpkgs/pkgs/tools/networking/hysteria/default.nix6
-rw-r--r--[-rwxr-xr-x]nixpkgs/pkgs/tools/networking/ipfetch/default.nix0
-rw-r--r--nixpkgs/pkgs/tools/networking/requestly/default.nix4
-rw-r--r--nixpkgs/pkgs/tools/networking/tgt/default.nix4
-rw-r--r--nixpkgs/pkgs/tools/networking/voms/default.nix15
-rw-r--r--nixpkgs/pkgs/tools/networking/xrootd/default.nix5
-rw-r--r--nixpkgs/pkgs/tools/package-management/zkg/default.nix42
-rw-r--r--nixpkgs/pkgs/tools/security/nuclei/default.nix7
-rw-r--r--nixpkgs/pkgs/tools/security/pynitrokey/default.nix4
-rw-r--r--nixpkgs/pkgs/tools/security/rekor/default.nix6
-rw-r--r--nixpkgs/pkgs/tools/security/scrypt/default.nix4
-rw-r--r--nixpkgs/pkgs/tools/security/sequoia-sqop/default.nix6
-rw-r--r--nixpkgs/pkgs/tools/security/uncover/default.nix6
-rw-r--r--nixpkgs/pkgs/tools/system/netdata/default.nix7
-rw-r--r--nixpkgs/pkgs/top-level/aliases.nix2
-rw-r--r--nixpkgs/pkgs/top-level/all-packages.nix37
-rw-r--r--nixpkgs/pkgs/top-level/perl-packages.nix7
-rw-r--r--nixpkgs/pkgs/top-level/python-aliases.nix1
-rw-r--r--nixpkgs/pkgs/top-level/python-packages.nix16
231 files changed, 2590 insertions, 740 deletions
diff --git a/nixpkgs/CONTRIBUTING.md b/nixpkgs/CONTRIBUTING.md
index 32201333c37b..06b9c10dfec6 100644
--- a/nixpkgs/CONTRIBUTING.md
+++ b/nixpkgs/CONTRIBUTING.md
@@ -565,7 +565,7 @@ Names of files and directories should be in lowercase, with dashes between words
 
 - Do not use tab characters, i.e. configure your editor to use soft tabs. For instance, use `(setq-default indent-tabs-mode nil)` in Emacs. Everybody has different tab settings so it’s asking for trouble.
 
-- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [](#sec-package-naming).
+- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [package naming](./pkgs/README.md#package-naming).
 
 - Function calls with attribute set arguments are written as
 
diff --git a/nixpkgs/doc/languages-frameworks/python.section.md b/nixpkgs/doc/languages-frameworks/python.section.md
index 40236d141d3d..cdd5c806912e 100644
--- a/nixpkgs/doc/languages-frameworks/python.section.md
+++ b/nixpkgs/doc/languages-frameworks/python.section.md
@@ -12,6 +12,7 @@
 | python310  | python3         | CPython 3.10 |
 | python311  |                 | CPython 3.11 |
 | python312  |                 | CPython 3.12 |
+| python313  |                 | CPython 3.13 |
 | pypy27     | pypy2, pypy     | PyPy2.7 |
 | pypy39     | pypy3           | PyPy 3.9 |
 
diff --git a/nixpkgs/maintainers/maintainer-list.nix b/nixpkgs/maintainers/maintainer-list.nix
index cba46849dbd1..36183e351999 100644
--- a/nixpkgs/maintainers/maintainer-list.nix
+++ b/nixpkgs/maintainers/maintainer-list.nix
@@ -1274,6 +1274,9 @@
     github = "antonmosich";
     githubId = 27223336;
     name = "Anton Mosich";
+    keys = [ {
+      fingerprint = "F401 287C 324F 0A1C B321  657B 9B96 97B8 FB18 7D14";
+    } ];
   };
   antono = {
     email = "self@antono.info";
@@ -3874,6 +3877,12 @@
     githubId = 50051176;
     name = "Daniel Rolls";
   };
+  danielsidhion = {
+    email = "nixpkgs@sidhion.com";
+    github = "DanielSidhion";
+    githubId = 160084;
+    name = "Daniel Sidhion";
+  };
   daniyalsuri6 = {
     email = "daniyal.suri@gmail.com";
     github = "daniyalsuri6";
@@ -6622,6 +6631,12 @@
     githubId = 4656860;
     name = "Gaute Ravndal";
   };
+  gray-heron = {
+    email = "ave+nix@cezar.info";
+    github = "gray-heron";
+    githubId = 7032646;
+    name = "Cezary Siwek";
+  };
   graysonhead = {
     email = "grayson@graysonhead.net";
     github = "graysonhead";
@@ -7219,6 +7234,7 @@
   };
   hubble = {
     name = "Hubble the Wolverine";
+    email = "hubblethewolverine@gmail.com";
     matrix = "@hubofeverything:bark.lgbt";
     github = "the-furry-hubofeverything";
     githubId = 53921912;
@@ -10923,6 +10939,12 @@
     githubId = 29855073;
     name = "Michael Colicchia";
   };
+  massimogengarelli = {
+    email = "massimo.gengarelli@gmail.com";
+    github = "massix";
+    githubId = 585424;
+    name = "Massimo Gengarelli";
+  };
   matejc = {
     email = "cotman.matej@gmail.com";
     github = "matejc";
@@ -11667,6 +11689,13 @@
     githubId = 149558;
     name = "Merlin Gaillard";
   };
+  mirkolenz = {
+    name = "Mirko Lenz";
+    email = "mirko@mirkolenz.com";
+    matrix = "@mlenz:matrix.org";
+    github = "mirkolenz";
+    githubId = 5160954;
+  };
   mirrexagon = {
     email = "mirrexagon@mirrexagon.com";
     github = "mirrexagon";
@@ -13903,6 +13932,12 @@
     githubId = 610615;
     name = "Chih-Mao Chen";
   };
+  pks = {
+    email = "ps@pks.im";
+    github = "pks-t";
+    githubId = 4056630;
+    name = "Patrick Steinhardt";
+  };
   plabadens = {
     name = "Pierre Labadens";
     email = "labadens.pierre+nixpkgs@gmail.com";
@@ -17797,6 +17832,12 @@
     githubId = 858790;
     name = "Tobias Mayer";
   };
+  tochiaha = {
+    email = "tochiahan@proton.me";
+    github = "Tochiaha";
+    githubId = 74688871;
+    name = "Tochukwu Ahanonu";
+  };
   tokudan = {
     email = "git@danielfrank.net";
     github = "tokudan";
@@ -17997,6 +18038,12 @@
     githubId = 15064765;
     name = "tshaynik";
   };
+  tsowell = {
+    email = "tom@ldtlb.com";
+    github = "tsowell";
+    githubId = 4044033;
+    name = "Thomas Sowell";
+  };
   ttuegel = {
     email = "ttuegel@mailbox.org";
     github = "ttuegel";
@@ -19349,6 +19396,11 @@
     github = "ymeister";
     githubId = 47071325;
   };
+  ymstnt = {
+    name = "YMSTNT";
+    github = "ymstnt";
+    githubId = 21342713;
+  };
   yoavlavi = {
     email = "yoav@yoavlavi.com";
     github = "yoav-lavi";
diff --git a/nixpkgs/maintainers/scripts/luarocks-packages.csv b/nixpkgs/maintainers/scripts/luarocks-packages.csv
index 5897948a9f83..f03ef4fa09c9 100644
--- a/nixpkgs/maintainers/scripts/luarocks-packages.csv
+++ b/nixpkgs/maintainers/scripts/luarocks-packages.csv
@@ -16,6 +16,7 @@ cyrussasl,https://github.com/JorjBauer/lua-cyrussasl.git,,,,,
 digestif,https://github.com/astoff/digestif.git,,,0.2-1,5.3,
 dkjson,,,,,,
 fennel,,,,,,misterio77
+ferris.nvim,,,,,,mrcjkb
 fifo,,,,,,
 fluent,,,,,,alerque
 gitsigns.nvim,https://github.com/lewis6991/gitsigns.nvim.git,,,,5.1,
diff --git a/nixpkgs/nixos/doc/manual/release-notes/rl-2311.section.md b/nixpkgs/nixos/doc/manual/release-notes/rl-2311.section.md
index 4c8b9898629b..91e0eb202021 100644
--- a/nixpkgs/nixos/doc/manual/release-notes/rl-2311.section.md
+++ b/nixpkgs/nixos/doc/manual/release-notes/rl-2311.section.md
@@ -258,6 +258,8 @@
 
 - Garage has been upgraded to 0.9.x. `services.garage.package` now needs to be explicitly set, so version upgrades can be done in a controlled fashion. For this, we expose `garage_x_y` attributes which can be set here.
 
+- `voms` and `xrootd` now moves the `$out/etc` content to the `$etc` output instead of `$out/etc.orig`, when input argument `externalEtc` is not `null`.
+
 - The `woodpecker-*` CI packages have been updated to 1.0.0. This release is wildly incompatible with the 0.15.X versions that were previously packaged. Please read [upstream's documentation](https://woodpecker-ci.org/docs/next/migrations#100) to learn how to update your CI configurations.
 
 - The Caddy module gained a new option named `services.caddy.enableReload` which is enabled by default. It allows reloading the service instead of restarting it, if only a config file has changed. This option must be disabled if you have turned off the [Caddy admin API](https://caddyserver.com/docs/caddyfile/options#admin). If you keep this option enabled, you should consider setting [`grace_period`](https://caddyserver.com/docs/caddyfile/options#grace-period) to a non-infinite value to prevent Caddy from delaying the reload indefinitely.
@@ -400,6 +402,8 @@ The module update takes care of the new config syntax and the data itself (user
 
 - Suricata was upgraded from 6.0 to 7.0 and no longer considers HTTP/2 support as experimental, see [upstream release notes](https://forum.suricata.io/t/suricata-7-0-0-released/3715) for more details.
 
+- Cloud support in the `netdata` package is now disabled by default. To enable it use the `netdataCloud` package.
+
 - `networking.nftables` now has the option `networking.nftables.table.<table>` to create tables
   and have them be updated atomically, instead of flushing the ruleset.
 
diff --git a/nixpkgs/nixos/lib/test-driver/test_driver/machine.py b/nixpkgs/nixos/lib/test-driver/test_driver/machine.py
index 7ed001a1dfce..b1688cd3b64f 100644
--- a/nixpkgs/nixos/lib/test-driver/test_driver/machine.py
+++ b/nixpkgs/nixos/lib/test-driver/test_driver/machine.py
@@ -791,6 +791,28 @@ class Machine:
         with self.nested(f"waiting for TCP port {port} on {addr}"):
             retry(port_is_open, timeout)
 
+    def wait_for_open_unix_socket(
+        self, addr: str, is_datagram: bool = False, timeout: int = 900
+    ) -> None:
+        """
+        Wait until a process is listening on the given UNIX-domain socket
+        (default to a UNIX-domain stream socket).
+        """
+
+        nc_flags = [
+            "-z",
+            "-uU" if is_datagram else "-U",
+        ]
+
+        def socket_is_open(_: Any) -> bool:
+            status, _ = self.execute(f"nc {' '.join(nc_flags)} {addr}")
+            return status == 0
+
+        with self.nested(
+            f"waiting for UNIX-domain {'datagram' if is_datagram else 'stream'} on '{addr}'"
+        ):
+            retry(socket_is_open, timeout)
+
     def wait_for_closed_port(
         self, port: int, addr: str = "localhost", timeout: int = 900
     ) -> None:
diff --git a/nixpkgs/nixos/modules/misc/ids.nix b/nixpkgs/nixos/modules/misc/ids.nix
index dc59ccb357d4..5b278b5e8062 100644
--- a/nixpkgs/nixos/modules/misc/ids.nix
+++ b/nixpkgs/nixos/modules/misc/ids.nix
@@ -69,7 +69,7 @@ in
       #dialout = 27; # unused
       polkituser = 28;
       #utmp = 29; # unused
-      # ddclient = 30; # software removed
+      # ddclient = 30; # converted to DynamicUser = true
       davfs2 = 31;
       disnix = 33;
       osgi = 34;
@@ -394,7 +394,7 @@ in
       dialout = 27;
       #polkituser = 28; # currently unused, polkitd doesn't need a group
       utmp = 29;
-      # ddclient = 30; # software removed
+      # ddclient = 30; # converted to DynamicUser = true
       davfs2 = 31;
       disnix = 33;
       osgi = 34;
diff --git a/nixpkgs/nixos/modules/module-list.nix b/nixpkgs/nixos/modules/module-list.nix
index 8fddb2185f2b..5108b8c42a30 100644
--- a/nixpkgs/nixos/modules/module-list.nix
+++ b/nixpkgs/nixos/modules/module-list.nix
@@ -885,6 +885,7 @@
   ./services/networking/dae.nix
   ./services/networking/dante.nix
   ./services/networking/deconz.nix
+  ./services/networking/ddclient.nix
   ./services/networking/dhcpcd.nix
   ./services/networking/dnscache.nix
   ./services/networking/dnscrypt-proxy2.nix
@@ -1154,6 +1155,7 @@
   ./services/security/hologram-agent.nix
   ./services/security/hologram-server.nix
   ./services/security/infnoise.nix
+  ./services/security/jitterentropy-rngd.nix
   ./services/security/kanidm.nix
   ./services/security/munge.nix
   ./services/security/nginx-sso.nix
diff --git a/nixpkgs/nixos/modules/programs/firefox.nix b/nixpkgs/nixos/modules/programs/firefox.nix
index 83a3edaf813e..99236f01c537 100644
--- a/nixpkgs/nixos/modules/programs/firefox.nix
+++ b/nixpkgs/nixos/modules/programs/firefox.nix
@@ -220,23 +220,20 @@ in
 
   config = mkIf cfg.enable {
     environment.systemPackages = [
-      (cfg.package.override {
+      (cfg.package.override (old: {
         extraPrefs = cfg.autoConfig;
-        extraNativeMessagingHosts = with pkgs; optionals nmh.ff2mpv [
-          ff2mpv
-        ] ++ optionals nmh.euwebid [
-          web-eid-app
-        ] ++ optionals nmh.gsconnect [
-          gnomeExtensions.gsconnect
-        ] ++ optionals nmh.jabref [
-          jabref
-        ] ++ optionals nmh.passff [
-          passff-host
-        ];
+        extraNativeMessagingHosts =
+          old.extraNativeMessagingHosts or []
+          ++ optional nmh.ff2mpv ff2mpv
+          ++ optional nmh.euwebid web-eid-app
+          ++ optional nmh.gsconnect gnomeExtensions.gsconnect
+          ++ optional nmh.jabref jabref
+          ++ optional nmh.passff passff-host;
         cfg = let
           # copy-pasted from the wrapper; TODO: figure out fix
           applicationName = cfg.package.binaryName or (lib.getName cfg.package);
 
+          oldCfg = old.cfg or {};
           nixpkgsConfig = pkgs.config.${applicationName} or {};
           optionConfig = cfg.wrapperConfig;
           nmhConfig = {
@@ -246,8 +243,8 @@ in
             enableUgetIntegrator = nmh.ugetIntegrator;
             enableFXCastBridge = nmh.fxCast;
           };
-        in nixpkgsConfig // optionConfig // nmhConfig;
-      })
+        in oldCfg // nixpkgsConfig // optionConfig // nmhConfig;
+      }))
     ];
 
     environment.etc =
diff --git a/nixpkgs/nixos/modules/rename.nix b/nixpkgs/nixos/modules/rename.nix
index 408c515044c8..0fbb2351f986 100644
--- a/nixpkgs/nixos/modules/rename.nix
+++ b/nixpkgs/nixos/modules/rename.nix
@@ -54,7 +54,6 @@ in
     (mkRemovedOptionModule [ "services" "chronos" ] "The corresponding package was removed from nixpkgs.")
     (mkRemovedOptionModule [ "services" "couchpotato" ] "The corresponding package was removed from nixpkgs.")
     (mkRemovedOptionModule [ "services" "dd-agent" ] "dd-agent was removed from nixpkgs in favor of the newer datadog-agent.")
-    (mkRemovedOptionModule [ "services" "ddclient" ] "ddclient has been removed on the request of the upstream maintainer because it is unmaintained and has bugs. Please switch to a different software like `inadyn` or `knsupdate`.") # Added 2023-07-04
     (mkRemovedOptionModule [ "services" "dnscrypt-proxy" ] "Use services.dnscrypt-proxy2 instead")
     (mkRemovedOptionModule [ "services" "exhibitor" ] "The corresponding package was removed from nixpkgs.")
     (mkRemovedOptionModule [ "services" "firefox" "syncserver" ] "The corresponding package was removed from nixpkgs.")
diff --git a/nixpkgs/nixos/modules/services/games/asf.nix b/nixpkgs/nixos/modules/services/games/asf.nix
index f15d7077d965..432de6336ce2 100644
--- a/nixpkgs/nixos/modules/services/games/asf.nix
+++ b/nixpkgs/nixos/modules/services/games/asf.nix
@@ -187,29 +187,41 @@ in
             Group = "asf";
             WorkingDirectory = cfg.dataDir;
             Type = "simple";
-            ExecStart = "${cfg.package}/bin/ArchiSteamFarm --path ${cfg.dataDir} --process-required --no-restart --service --no-config-migrate";
+            ExecStart = "${lib.getExe cfg.package} --no-restart --process-required --service --system-required --path ${cfg.dataDir}";
             Restart = "always";
 
-            # mostly copied from the default systemd service
-            PrivateTmp = true;
+            # copied from the default systemd service at
+            # https://github.com/JustArchiNET/ArchiSteamFarm/blob/main/ArchiSteamFarm/overlay/variant-base/linux/ArchiSteamFarm%40.service
+            CapabilityBoundingSet = "";
+            DevicePolicy = "closed";
             LockPersonality = true;
+            NoNewPrivileges = true;
             PrivateDevices = true;
             PrivateIPC = true;
             PrivateMounts = true;
+            PrivateTmp = true; # instead of rw /tmp
             PrivateUsers = true;
+            ProcSubset = "pid";
             ProtectClock = true;
             ProtectControlGroups = true;
+            ProtectHome = true;
             ProtectHostname = true;
             ProtectKernelLogs = true;
             ProtectKernelModules = true;
             ProtectKernelTunables = true;
             ProtectProc = "invisible";
-            ProtectSystem = "full";
+            ProtectSystem = "strict";
             RemoveIPC = true;
-            RestrictAddressFamilies = "AF_INET AF_INET6";
+            RestrictAddressFamilies = "AF_INET AF_INET6 AF_NETLINK AF_UNIX";
             RestrictNamespaces = true;
             RestrictRealtime = true;
             RestrictSUIDSGID = true;
+            SystemCallArchitectures = "native";
+            UMask = "0077";
+
+            # we luckily already have systemd v247+
+            SecureBits = "noroot-locked";
+            SystemCallFilter = [ "@system-service" "~@privileged" ];
           }
         ];
 
diff --git a/nixpkgs/nixos/modules/services/misc/confd.nix b/nixpkgs/nixos/modules/services/misc/confd.nix
index 17c1be57ccbc..17c1be57ccbc 100755..100644
--- a/nixpkgs/nixos/modules/services/misc/confd.nix
+++ b/nixpkgs/nixos/modules/services/misc/confd.nix
diff --git a/nixpkgs/nixos/modules/services/networking/ddclient.nix b/nixpkgs/nixos/modules/services/networking/ddclient.nix
new file mode 100644
index 000000000000..8f4fb0bc78d4
--- /dev/null
+++ b/nixpkgs/nixos/modules/services/networking/ddclient.nix
@@ -0,0 +1,234 @@
+{ config, pkgs, lib, ... }:
+
+let
+  cfg = config.services.ddclient;
+  boolToStr = bool: if bool then "yes" else "no";
+  dataDir = "/var/lib/ddclient";
+  StateDirectory = builtins.baseNameOf dataDir;
+  RuntimeDirectory = StateDirectory;
+
+  configFile' = pkgs.writeText "ddclient.conf" ''
+    # This file can be used as a template for configFile or is automatically generated by Nix options.
+    cache=${dataDir}/ddclient.cache
+    foreground=YES
+    use=${cfg.use}
+    login=${cfg.username}
+    password=${if cfg.protocol == "nsupdate" then "/run/${RuntimeDirectory}/ddclient.key" else "@password_placeholder@"}
+    protocol=${cfg.protocol}
+    ${lib.optionalString (cfg.script != "") "script=${cfg.script}"}
+    ${lib.optionalString (cfg.server != "") "server=${cfg.server}"}
+    ${lib.optionalString (cfg.zone != "")   "zone=${cfg.zone}"}
+    ssl=${boolToStr cfg.ssl}
+    wildcard=YES
+    quiet=${boolToStr cfg.quiet}
+    verbose=${boolToStr cfg.verbose}
+    ${cfg.extraConfig}
+    ${lib.concatStringsSep "," cfg.domains}
+  '';
+  configFile = if (cfg.configFile != null) then cfg.configFile else configFile';
+
+  preStart = ''
+    install --mode=600 --owner=$USER ${configFile} /run/${RuntimeDirectory}/ddclient.conf
+    ${lib.optionalString (cfg.configFile == null) (if (cfg.protocol == "nsupdate") then ''
+      install --mode=600 --owner=$USER ${cfg.passwordFile} /run/${RuntimeDirectory}/ddclient.key
+    '' else if (cfg.passwordFile != null) then ''
+      "${pkgs.replace-secret}/bin/replace-secret" "@password_placeholder@" "${cfg.passwordFile}" "/run/${RuntimeDirectory}/ddclient.conf"
+    '' else ''
+      sed -i '/^password=@password_placeholder@$/d' /run/${RuntimeDirectory}/ddclient.conf
+    '')}
+  '';
+
+in
+
+with lib;
+
+{
+
+  imports = [
+    (mkChangedOptionModule [ "services" "ddclient" "domain" ] [ "services" "ddclient" "domains" ]
+      (config:
+        let value = getAttrFromPath [ "services" "ddclient" "domain" ] config;
+        in optional (value != "") value))
+    (mkRemovedOptionModule [ "services" "ddclient" "homeDir" ] "")
+    (mkRemovedOptionModule [ "services" "ddclient" "password" ] "Use services.ddclient.passwordFile instead.")
+    (mkRemovedOptionModule [ "services" "ddclient" "ipv6" ] "")
+  ];
+
+  ###### interface
+
+  options = {
+
+    services.ddclient = with lib.types; {
+
+      enable = mkOption {
+        default = false;
+        type = bool;
+        description = lib.mdDoc ''
+          Whether to synchronise your machine's IP address with a dynamic DNS provider (e.g. dyndns.org).
+        '';
+      };
+
+      package = mkOption {
+        type = package;
+        default = pkgs.ddclient;
+        defaultText = lib.literalExpression "pkgs.ddclient";
+        description = lib.mdDoc ''
+          The ddclient executable package run by the service.
+        '';
+      };
+
+      domains = mkOption {
+        default = [ "" ];
+        type = listOf str;
+        description = lib.mdDoc ''
+          Domain name(s) to synchronize.
+        '';
+      };
+
+      username = mkOption {
+        # For `nsupdate` username contains the path to the nsupdate executable
+        default = lib.optionalString (config.services.ddclient.protocol == "nsupdate") "${pkgs.bind.dnsutils}/bin/nsupdate";
+        defaultText = "";
+        type = str;
+        description = lib.mdDoc ''
+          User name.
+        '';
+      };
+
+      passwordFile = mkOption {
+        default = null;
+        type = nullOr str;
+        description = lib.mdDoc ''
+          A file containing the password or a TSIG key in named format when using the nsupdate protocol.
+        '';
+      };
+
+      interval = mkOption {
+        default = "10min";
+        type = str;
+        description = lib.mdDoc ''
+          The interval at which to run the check and update.
+          See {command}`man 7 systemd.time` for the format.
+        '';
+      };
+
+      configFile = mkOption {
+        default = null;
+        type = nullOr path;
+        description = lib.mdDoc ''
+          Path to configuration file.
+          When set this overrides the generated configuration from module options.
+        '';
+        example = "/root/nixos/secrets/ddclient.conf";
+      };
+
+      protocol = mkOption {
+        default = "dyndns2";
+        type = str;
+        description = lib.mdDoc ''
+          Protocol to use with dynamic DNS provider (see https://sourceforge.net/p/ddclient/wiki/protocols).
+        '';
+      };
+
+      server = mkOption {
+        default = "";
+        type = str;
+        description = lib.mdDoc ''
+          Server address.
+        '';
+      };
+
+      ssl = mkOption {
+        default = true;
+        type = bool;
+        description = lib.mdDoc ''
+          Whether to use SSL/TLS to connect to dynamic DNS provider.
+        '';
+      };
+
+      quiet = mkOption {
+        default = false;
+        type = bool;
+        description = lib.mdDoc ''
+          Print no messages for unnecessary updates.
+        '';
+      };
+
+      script = mkOption {
+        default = "";
+        type = str;
+        description = lib.mdDoc ''
+          script as required by some providers.
+        '';
+      };
+
+      use = mkOption {
+        default = "web, web=checkip.dyndns.com/, web-skip='Current IP Address: '";
+        type = str;
+        description = lib.mdDoc ''
+          Method to determine the IP address to send to the dynamic DNS provider.
+        '';
+      };
+
+      verbose = mkOption {
+        default = false;
+        type = bool;
+        description = lib.mdDoc ''
+          Print verbose information.
+        '';
+      };
+
+      zone = mkOption {
+        default = "";
+        type = str;
+        description = lib.mdDoc ''
+          zone as required by some providers.
+        '';
+      };
+
+      extraConfig = mkOption {
+        default = "";
+        type = lines;
+        description = lib.mdDoc ''
+          Extra configuration. Contents will be added verbatim to the configuration file.
+
+          ::: {.note}
+          `daemon` should not be added here because it does not work great with the systemd-timer approach the service uses.
+          :::
+        '';
+      };
+    };
+  };
+
+
+  ###### implementation
+
+  config = mkIf config.services.ddclient.enable {
+    systemd.services.ddclient = {
+      description = "Dynamic DNS Client";
+      wantedBy = [ "multi-user.target" ];
+      after = [ "network.target" ];
+      restartTriggers = optional (cfg.configFile != null) cfg.configFile;
+      path = lib.optional (lib.hasPrefix "if," cfg.use) pkgs.iproute2;
+
+      serviceConfig = {
+        DynamicUser = true;
+        RuntimeDirectoryMode = "0700";
+        inherit RuntimeDirectory;
+        inherit StateDirectory;
+        Type = "oneshot";
+        ExecStartPre = "!${pkgs.writeShellScript "ddclient-prestart" preStart}";
+        ExecStart = "${lib.getExe cfg.package} -file /run/${RuntimeDirectory}/ddclient.conf";
+      };
+    };
+
+    systemd.timers.ddclient = {
+      description = "Run ddclient";
+      wantedBy = [ "timers.target" ];
+      timerConfig = {
+        OnBootSec = cfg.interval;
+        OnUnitInactiveSec = cfg.interval;
+      };
+    };
+  };
+}
diff --git a/nixpkgs/nixos/modules/services/networking/networkmanager.nix b/nixpkgs/nixos/modules/services/networking/networkmanager.nix
index 53c847ee3ca2..d32712c8243d 100644
--- a/nixpkgs/nixos/modules/services/networking/networkmanager.nix
+++ b/nixpkgs/nixos/modules/services/networking/networkmanager.nix
@@ -4,6 +4,7 @@ with lib;
 
 let
   cfg = config.networking.networkmanager;
+  ini = pkgs.formats.ini { };
 
   delegateWireless = config.networking.wireless.enable == true && cfg.unmanaged != [ ];
 
@@ -379,6 +380,74 @@ in
           https://modemmanager.org/docs/modemmanager/fcc-unlock/#integration-with-third-party-fcc-unlock-tools.
         '';
       };
+      ensureProfiles = {
+        profiles = with lib.types; mkOption {
+          type = attrsOf (submodule {
+            freeformType = ini.type;
+
+            options = {
+              connection = {
+                id = lib.mkOption {
+                  type = str;
+                  description = "This is the name that will be displayed by NetworkManager and GUIs.";
+                };
+                type = lib.mkOption {
+                  type = str;
+                  description = "The connection type defines the connection kind, like vpn, wireguard, gsm, wifi and more.";
+                  example = "vpn";
+                };
+              };
+            };
+          });
+          apply = (lib.filterAttrsRecursive (n: v: v != { }));
+          default = { };
+          example = {
+            home-wifi = {
+              connection = {
+                id = "home-wifi";
+                type = "wifi";
+                permissions = "";
+              };
+              wifi = {
+                mac-address-blacklist = "";
+                mode = "infrastructure";
+                ssid = "Home Wi-Fi";
+              };
+              wifi-security = {
+                auth-alg = "open";
+                key-mgmt = "wpa-psk";
+                psk = "$HOME_WIFI_PASSWORD";
+              };
+              ipv4 = {
+                dns-search = "";
+                method = "auto";
+              };
+              ipv6 = {
+                addr-gen-mode = "stable-privacy";
+                dns-search = "";
+                method = "auto";
+              };
+            };
+          };
+          description = lib.mdDoc ''
+            Declaratively define NetworkManager profiles. You can find information about the generated file format [here](https://networkmanager.dev/docs/api/latest/nm-settings-keyfile.html) and [here](https://access.redhat.com/documentation/en-us/red_hat_enterprise_linux/8/html/configuring_and_managing_networking/assembly_networkmanager-connection-profiles-in-keyfile-format_configuring-and-managing-networking).
+            You current profiles which are most likely stored in `/etc/NetworkManager/system-connections` and there is [a tool](https://github.com/janik-haag/nm2nix) to convert them to the needed nix code.
+            If you add a new ad-hoc connection via a GUI or nmtui or anything similar it should just work together with the declarative ones.
+            And if you edit a declarative profile NetworkManager will move it to the persistent storage and treat it like a ad-hoc one,
+            but there will be two profiles as soon as the systemd unit from this option runs again which can be confusing since NetworkManager tools will start displaying two profiles with the same name and probably a bit different settings depending on what you edited.
+            A profile won't be deleted even if it's removed from the config until the system reboots because that's when NetworkManager clears it's temp directory.
+          '';
+        };
+        environmentFiles = mkOption {
+          default = [];
+          type = types.listOf types.path;
+          example = [ "/run/secrets/network-manager.env" ];
+          description = lib.mdDoc ''
+            Files to load as environment file. Environment variables from this file
+            will be substituted into the static configuration file using [envsubst](https://github.com/a8m/envsubst).
+          '';
+        };
+      };
     };
   };
 
@@ -507,6 +576,30 @@ in
       aliases = [ "dbus-org.freedesktop.nm-dispatcher.service" ];
     };
 
+    systemd.services.NetworkManager-ensure-profiles = mkIf (cfg.ensureProfiles.profiles != { }) {
+      description = "Ensure that NetworkManager declarative profiles are created";
+      wantedBy = [ "multi-user.target" ];
+      before = [ "network-online.target" ];
+      script = let
+        path = id: "/run/NetworkManager/system-connections/${id}.nmconnection";
+      in ''
+        mkdir -p /run/NetworkManager/system-connections
+      '' + lib.concatMapStringsSep "\n"
+        (profile: ''
+          ${pkgs.envsubst}/bin/envsubst -i ${ini.generate (lib.escapeShellArg profile.n) profile.v} > ${path (lib.escapeShellArg profile.n)}
+        '') (lib.mapAttrsToList (n: v: { inherit n v; }) cfg.ensureProfiles.profiles)
+      + ''
+        if systemctl is-active --quiet NetworkManager; then
+          ${pkgs.networkmanager}/bin/nmcli connection reload
+        fi
+      '';
+      serviceConfig = {
+        EnvironmentFile = cfg.ensureProfiles.environmentFiles;
+        UMask = "0177";
+        Type = "oneshot";
+      };
+    };
+
     # Turn off NixOS' network management when networking is managed entirely by NetworkManager
     networking = mkMerge [
       (mkIf (!delegateWireless) {
diff --git a/nixpkgs/nixos/modules/services/security/fail2ban.nix b/nixpkgs/nixos/modules/services/security/fail2ban.nix
index 7059284850a5..235f29ab8a6a 100644
--- a/nixpkgs/nixos/modules/services/security/fail2ban.nix
+++ b/nixpkgs/nixos/modules/services/security/fail2ban.nix
@@ -103,9 +103,9 @@ in
       };
 
       bantime = mkOption {
-        default = null;
-        type = types.nullOr types.str;
-        example = "10m";
+        default = "10m";
+        type = types.str;
+        example = "1h";
         description = lib.mdDoc "Number of seconds that a host is banned.";
       };
 
diff --git a/nixpkgs/nixos/modules/services/security/jitterentropy-rngd.nix b/nixpkgs/nixos/modules/services/security/jitterentropy-rngd.nix
new file mode 100644
index 000000000000..7bfacb5ddc5d
--- /dev/null
+++ b/nixpkgs/nixos/modules/services/security/jitterentropy-rngd.nix
@@ -0,0 +1,18 @@
+{ lib, config, pkgs, ... }:
+let
+  cfg = config.services.jitterentropy-rngd;
+in
+{
+  options.services.jitterentropy-rngd = {
+    enable =
+      lib.mkEnableOption (lib.mdDoc "jitterentropy-rngd service configuration");
+    package = lib.mkPackageOptionMD pkgs "jitterentropy-rngd" { };
+  };
+
+  config = lib.mkIf cfg.enable {
+    systemd.packages = [ cfg.package ];
+    systemd.services."jitterentropy".wantedBy = [ "basic.target" ];
+  };
+
+  meta.maintainers = with lib.maintainers; [ thillux ];
+}
diff --git a/nixpkgs/nixos/modules/services/web-servers/nginx/default.nix b/nixpkgs/nixos/modules/services/web-servers/nginx/default.nix
index 955d6e19064e..9eebd18855c7 100644
--- a/nixpkgs/nixos/modules/services/web-servers/nginx/default.nix
+++ b/nixpkgs/nixos/modules/services/web-servers/nginx/default.nix
@@ -329,7 +329,7 @@ let
         listenString = { addr, port, ssl, proxyProtocol ? false, extraParameters ? [], ... }:
           # UDP listener for QUIC transport protocol.
           (optionalString (ssl && vhost.quic) ("
-            listen ${addr}:${toString port} quic "
+            listen ${addr}${optionalString (port != null) ":${toString port}"} quic "
           + optionalString vhost.default "default_server "
           + optionalString vhost.reuseport "reuseport "
           + optionalString (extraParameters != []) (concatStringsSep " "
@@ -338,7 +338,7 @@ let
             in filter isCompatibleParameter extraParameters))
           + ";"))
           + "
-            listen ${addr}:${toString port} "
+            listen ${addr}${optionalString (port != null) ":${toString port}"} "
           + optionalString (ssl && vhost.http2 && oldHTTP2) "http2 "
           + optionalString ssl "ssl "
           + optionalString vhost.default "default_server "
diff --git a/nixpkgs/nixos/modules/services/web-servers/nginx/vhost-options.nix b/nixpkgs/nixos/modules/services/web-servers/nginx/vhost-options.nix
index 7636c1b26115..c82f02ecefec 100644
--- a/nixpkgs/nixos/modules/services/web-servers/nginx/vhost-options.nix
+++ b/nixpkgs/nixos/modules/services/web-servers/nginx/vhost-options.nix
@@ -31,12 +31,12 @@ with lib;
         options = {
           addr = mkOption {
             type = str;
-            description = lib.mdDoc "IP address.";
+            description = lib.mdDoc "Listen address.";
           };
           port = mkOption {
-            type = port;
+            type = types.nullOr port;
             description = lib.mdDoc "Port number.";
-            default = 80;
+            default = null;
           };
           ssl = mkOption {
             type = bool;
@@ -60,6 +60,7 @@ with lib;
       example = [
         { addr = "195.154.1.1"; port = 443; ssl = true; }
         { addr = "192.154.1.1"; port = 80; }
+        { addr = "unix:/var/run/nginx.sock"; }
       ];
       description = lib.mdDoc ''
         Listen addresses and ports for this virtual host.
diff --git a/nixpkgs/nixos/modules/system/boot/systemd/initrd.nix b/nixpkgs/nixos/modules/system/boot/systemd/initrd.nix
index 61af2768e295..175e757cbbb6 100644
--- a/nixpkgs/nixos/modules/system/boot/systemd/initrd.nix
+++ b/nixpkgs/nixos/modules/system/boot/systemd/initrd.nix
@@ -358,7 +358,7 @@ in {
     ++ lib.optional (cfg.enableTpm2 && !(pkgs.stdenv.hostPlatform.isRiscV64 || pkgs.stdenv.hostPlatform.isArmv7)) "tpm-crb";
 
     boot.initrd.systemd = {
-      initrdBin = [pkgs.bash pkgs.coreutils cfg.package.kmod cfg.package] ++ config.system.fsPackages;
+      initrdBin = [pkgs.bash pkgs.coreutils cfg.package.kmod cfg.package];
       extraBin = {
         less = "${pkgs.less}/bin/less";
         mount = "${cfg.package.util-linux}/bin/mount";
diff --git a/nixpkgs/nixos/modules/tasks/filesystems/btrfs.nix b/nixpkgs/nixos/modules/tasks/filesystems/btrfs.nix
index 82fdd6058710..87fe326c0974 100644
--- a/nixpkgs/nixos/modules/tasks/filesystems/btrfs.nix
+++ b/nixpkgs/nixos/modules/tasks/filesystems/btrfs.nix
@@ -52,34 +52,37 @@ in
   config = mkMerge [
     (mkIf enableBtrfs {
       system.fsPackages = [ pkgs.btrfs-progs ];
+    })
 
-      boot.initrd.kernelModules = mkIf inInitrd [ "btrfs" ];
-      boot.initrd.availableKernelModules = mkIf inInitrd (
+    (mkIf inInitrd {
+      boot.initrd.kernelModules = [ "btrfs" ];
+      boot.initrd.availableKernelModules =
         [ "crc32c" ]
         ++ optionals (config.boot.kernelPackages.kernel.kernelAtLeast "5.5") [
           # Needed for mounting filesystems with new checksums
           "xxhash_generic"
           "blake2b_generic"
           "sha256_generic" # Should be baked into our kernel, just to be sure
-        ]
-      );
+        ];
 
-      boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable)
+      boot.initrd.extraUtilsCommands = mkIf (!config.boot.initrd.systemd.enable)
       ''
         copy_bin_and_libs ${pkgs.btrfs-progs}/bin/btrfs
         ln -sv btrfs $out/bin/btrfsck
         ln -sv btrfsck $out/bin/fsck.btrfs
       '';
 
-      boot.initrd.extraUtilsCommandsTest = mkIf (inInitrd && !config.boot.initrd.systemd.enable)
+      boot.initrd.extraUtilsCommandsTest = mkIf (!config.boot.initrd.systemd.enable)
       ''
         $out/bin/btrfs --version
       '';
 
-      boot.initrd.postDeviceCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable)
+      boot.initrd.postDeviceCommands = mkIf (!config.boot.initrd.systemd.enable)
       ''
         btrfs device scan
       '';
+
+      boot.initrd.systemd.initrdBin = [ pkgs.btrfs-progs ];
     })
 
     (mkIf enableAutoScrub {
diff --git a/nixpkgs/nixos/modules/tasks/filesystems/cifs.nix b/nixpkgs/nixos/modules/tasks/filesystems/cifs.nix
index 0de292a69208..837b9e19bfb9 100644
--- a/nixpkgs/nixos/modules/tasks/filesystems/cifs.nix
+++ b/nixpkgs/nixos/modules/tasks/filesystems/cifs.nix
@@ -21,5 +21,7 @@ in
         copy_bin_and_libs ${pkgs.cifs-utils}/sbin/mount.cifs
       '';
 
+    boot.initrd.systemd.extraBin."mount.cifs" = mkIf inInitrd "${pkgs.cifs-utils}/sbin/mount.cifs";
+
   };
 }
diff --git a/nixpkgs/nixos/modules/tasks/filesystems/ext.nix b/nixpkgs/nixos/modules/tasks/filesystems/ext.nix
index edc0efc55213..1c34ee2c7035 100644
--- a/nixpkgs/nixos/modules/tasks/filesystems/ext.nix
+++ b/nixpkgs/nixos/modules/tasks/filesystems/ext.nix
@@ -25,5 +25,7 @@ in
         ln -sv e2fsck $out/bin/fsck.ext4
       '';
 
+    boot.initrd.systemd.initrdBin = lib.mkIf inInitrd [ pkgs.e2fsprogs ];
+
   };
 }
diff --git a/nixpkgs/nixos/modules/tasks/filesystems/f2fs.nix b/nixpkgs/nixos/modules/tasks/filesystems/f2fs.nix
index 035784f43df8..4f99f9a57fa6 100644
--- a/nixpkgs/nixos/modules/tasks/filesystems/f2fs.nix
+++ b/nixpkgs/nixos/modules/tasks/filesystems/f2fs.nix
@@ -16,5 +16,7 @@ in
     boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) ''
       copy_bin_and_libs ${pkgs.f2fs-tools}/sbin/fsck.f2fs
     '';
+
+    boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.f2fs-tools ];
   };
 }
diff --git a/nixpkgs/nixos/modules/tasks/filesystems/jfs.nix b/nixpkgs/nixos/modules/tasks/filesystems/jfs.nix
index 6d80c4c657da..b5132b4caa33 100644
--- a/nixpkgs/nixos/modules/tasks/filesystems/jfs.nix
+++ b/nixpkgs/nixos/modules/tasks/filesystems/jfs.nix
@@ -15,5 +15,7 @@ in
     boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) ''
       copy_bin_and_libs ${pkgs.jfsutils}/sbin/fsck.jfs
     '';
+
+    boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.jfsutils ];
   };
 }
diff --git a/nixpkgs/nixos/modules/tasks/filesystems/reiserfs.nix b/nixpkgs/nixos/modules/tasks/filesystems/reiserfs.nix
index 7b017a83db84..3c6a0f0cd917 100644
--- a/nixpkgs/nixos/modules/tasks/filesystems/reiserfs.nix
+++ b/nixpkgs/nixos/modules/tasks/filesystems/reiserfs.nix
@@ -21,5 +21,7 @@ in
         ln -s reiserfsck $out/bin/fsck.reiserfs
       '';
 
+    boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.reiserfsprogs ];
+
   };
 }
diff --git a/nixpkgs/nixos/modules/tasks/filesystems/vfat.nix b/nixpkgs/nixos/modules/tasks/filesystems/vfat.nix
index 5421b617b43b..e535e97759b2 100644
--- a/nixpkgs/nixos/modules/tasks/filesystems/vfat.nix
+++ b/nixpkgs/nixos/modules/tasks/filesystems/vfat.nix
@@ -21,5 +21,7 @@ in
         ln -sv dosfsck $out/bin/fsck.vfat
       '';
 
+    boot.initrd.systemd.extraBin = mkIf inInitrd [ pkgs.dosfstools ];
+
   };
 }
diff --git a/nixpkgs/nixos/modules/tasks/filesystems/xfs.nix b/nixpkgs/nixos/modules/tasks/filesystems/xfs.nix
index f81f58646551..76f31e660ad3 100644
--- a/nixpkgs/nixos/modules/tasks/filesystems/xfs.nix
+++ b/nixpkgs/nixos/modules/tasks/filesystems/xfs.nix
@@ -26,5 +26,7 @@ in
       ''
         sed -i -e 's,^#!.*,#!'$out/bin/sh, $out/bin/fsck.xfs
       '';
+
+    boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.xfsprogs.bin ];
   };
 }
diff --git a/nixpkgs/nixos/modules/tasks/filesystems/zfs.nix b/nixpkgs/nixos/modules/tasks/filesystems/zfs.nix
index 5cf863c87f27..082634ec9d01 100644
--- a/nixpkgs/nixos/modules/tasks/filesystems/zfs.nix
+++ b/nixpkgs/nixos/modules/tasks/filesystems/zfs.nix
@@ -90,12 +90,17 @@ let
 
   getPoolMounts = prefix: pool:
     let
+      poolFSes = getPoolFilesystems pool;
+
       # Remove the "/" suffix because even though most mountpoints
       # won't have it, the "/" mountpoint will, and we can't have the
       # trailing slash in "/sysroot/" in stage 1.
       mountPoint = fs: escapeSystemdPath (prefix + (lib.removeSuffix "/" fs.mountPoint));
+
+      hasUsr = lib.any (fs: fs.mountPoint == "/usr") poolFSes;
     in
-      map (x: "${mountPoint x}.mount") (getPoolFilesystems pool);
+      map (x: "${mountPoint x}.mount") poolFSes
+      ++ lib.optional hasUsr "sysusr-usr.mount";
 
   getKeyLocations = pool: if isBool cfgZfs.requestEncryptionCredentials then {
     hasKeys = cfgZfs.requestEncryptionCredentials;
@@ -632,7 +637,8 @@ in
           targets.zfs-import.wantedBy = [ "zfs.target" ];
           targets.zfs.wantedBy = [ "initrd.target" ];
           extraBin = {
-            # zpool and zfs are already in thanks to fsPackages
+            zpool = "${cfgZfs.package}/sbin/zpool";
+            zfs = "${cfgZfs.package}/sbin/zfs";
             awk = "${pkgs.gawk}/bin/awk";
           };
         };
diff --git a/nixpkgs/nixos/tests/all-tests.nix b/nixpkgs/nixos/tests/all-tests.nix
index 33f8abf6ccd4..88fcbd59a1e7 100644
--- a/nixpkgs/nixos/tests/all-tests.nix
+++ b/nixpkgs/nixos/tests/all-tests.nix
@@ -559,6 +559,7 @@ in {
   nginx-sso = handleTest ./nginx-sso.nix {};
   nginx-status-page = handleTest ./nginx-status-page.nix {};
   nginx-tmpdir = handleTest ./nginx-tmpdir.nix {};
+  nginx-unix-socket = handleTest ./nginx-unix-socket.nix {};
   nginx-variants = handleTest ./nginx-variants.nix {};
   nifi = handleTestOn ["x86_64-linux"] ./web-apps/nifi.nix {};
   nitter = handleTest ./nitter.nix {};
diff --git a/nixpkgs/nixos/tests/installer.nix b/nixpkgs/nixos/tests/installer.nix
index 3268a16967d7..5111cedf9256 100644
--- a/nixpkgs/nixos/tests/installer.nix
+++ b/nixpkgs/nixos/tests/installer.nix
@@ -690,6 +690,9 @@ in {
           "zpool create rpool /dev/vda2",
           "zfs create -o mountpoint=legacy rpool/root",
           "mount -t zfs rpool/root /mnt",
+          "zfs create -o mountpoint=legacy rpool/root/usr",
+          "mkdir /mnt/usr",
+          "mount -t zfs rpool/root/usr /mnt/usr",
           "udevadm settle",
       )
     '';
diff --git a/nixpkgs/nixos/tests/nginx-unix-socket.nix b/nixpkgs/nixos/tests/nginx-unix-socket.nix
new file mode 100644
index 000000000000..4640eaa171bd
--- /dev/null
+++ b/nixpkgs/nixos/tests/nginx-unix-socket.nix
@@ -0,0 +1,27 @@
+import ./make-test-python.nix ({ pkgs, ... }:
+let
+  nginxSocketPath = "/var/run/nginx/test.sock";
+in
+{
+  name = "nginx-unix-socket";
+
+  nodes = {
+    webserver = { pkgs, lib, ... }: {
+      services.nginx = {
+        enable = true;
+        virtualHosts.localhost = {
+          serverName = "localhost";
+          listen = [{ addr = "unix:${nginxSocketPath}"; }];
+          locations."/test".return = "200 'foo'";
+        };
+      };
+    };
+  };
+
+  testScript = ''
+    webserver.wait_for_unit("nginx")
+    webserver.wait_for_open_unix_socket("${nginxSocketPath}")
+
+    webserver.succeed("curl --fail --silent --unix-socket '${nginxSocketPath}' http://localhost/test | grep '^foo$'")
+  '';
+})
diff --git a/nixpkgs/pkgs/applications/audio/soundwireserver/default.nix b/nixpkgs/pkgs/applications/audio/soundwireserver/default.nix
index b296ebdad602..b296ebdad602 100755..100644
--- a/nixpkgs/pkgs/applications/audio/soundwireserver/default.nix
+++ b/nixpkgs/pkgs/applications/audio/soundwireserver/default.nix
diff --git a/nixpkgs/pkgs/applications/blockchains/snarkos/default.nix b/nixpkgs/pkgs/applications/blockchains/snarkos/default.nix
index 080cc4b5c108..000c1ace4a4c 100644
--- a/nixpkgs/pkgs/applications/blockchains/snarkos/default.nix
+++ b/nixpkgs/pkgs/applications/blockchains/snarkos/default.nix
@@ -10,16 +10,16 @@
 }:
 rustPlatform.buildRustPackage rec {
   pname = "snarkos";
-  version = "2.1.7";
+  version = "2.2.1";
 
   src = fetchFromGitHub {
     owner = "AleoHQ";
     repo = "snarkOS";
     rev = "v${version}";
-    sha256 = "sha256-kW41SNbl2vckgUth+BZ6/aM03aT6MFeY4Hwi9OVWtTI=";
+    sha256 = "sha256-vEoEnjVjxVnjZ3Lya1qO2kOypNu07aYSlrSya5NJZzs=";
   };
 
-  cargoHash = "sha256-znEAb4q9H0Doc+XYCf27hV/z2t74kjQUffl/aJzW6tI=";
+  cargoHash = "sha256-CVHvBqfcTqWBtLFcEcs9y/LmQ4gXjX+dfqqZSxN+33A=";
 
   # buildAndTestSubdir = "cli";
 
diff --git a/nixpkgs/pkgs/applications/blockchains/trezor-suite/default.nix b/nixpkgs/pkgs/applications/blockchains/trezor-suite/default.nix
index c56e6da52f0f..e5f8963e921c 100644
--- a/nixpkgs/pkgs/applications/blockchains/trezor-suite/default.nix
+++ b/nixpkgs/pkgs/applications/blockchains/trezor-suite/default.nix
@@ -8,7 +8,7 @@
 
 let
   pname = "trezor-suite";
-  version = "23.4.2";
+  version = "23.10.1";
   name = "${pname}-${version}";
 
   suffix = {
@@ -19,8 +19,8 @@ let
   src = fetchurl {
     url = "https://github.com/trezor/${pname}/releases/download/v${version}/Trezor-Suite-${version}-${suffix}.AppImage";
     hash = { # curl -Lfs https://github.com/trezor/trezor-suite/releases/latest/download/latest-linux{-arm64,}.yml | grep ^sha512 | sed 's/: /-/'
-      aarch64-linux = "sha512-+dcogzj0mENWSAVKqUG/xyF+TD/nKpA3UiNyI2M7iiCaW+tpwO5Y0uUmzb1rFRtDsKMflDPZNWe8qMJmrtaIrA==";
-      x86_64-linux  = "sha512-8UyPa3hDmALiYGao451ZBQLxv9H9OLbzzHiANp4zgvjBLGNhZnPFBIYM6KGyKkgRJJiTcgd7VHCgEhPpfm0qzg==";
+      aarch64-linux = "sha512-MR9BYg6R+Oof3zh02KSh48V2m6J7JpsrYpi6gj5kTvKuCU5Ci5AwPEAvnTjHAR6xlappvoNQmeA5nCEoTWaL7A==";
+      x86_64-linux  = "sha512-BqdfhYLG4z+9B7KbJGWGPml7U2fl/RQ1nZK0vdeA/cKhG0SjH0K8er9bemg60RPBXj0AeuK80v/6vMbDtyEnRQ==";
     }.${stdenv.hostPlatform.system} or (throw "Unsupported system: ${stdenv.hostPlatform.system}");
   };
 
diff --git a/nixpkgs/pkgs/applications/editors/jetbrains/plugins/plugins.json b/nixpkgs/pkgs/applications/editors/jetbrains/plugins/plugins.json
index d93a243b0a37..353d4a5d4b0b 100644
--- a/nixpkgs/pkgs/applications/editors/jetbrains/plugins/plugins.json
+++ b/nixpkgs/pkgs/applications/editors/jetbrains/plugins/plugins.json
@@ -22,10 +22,10 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
         "232.10072.27": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
         "232.10072.28": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
         "232.9921.42": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
         "232.9921.83": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
         "233.8264.22": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip"
       },
       "name": "ideavim"
@@ -61,10 +61,10 @@
         "232.10072.21": null,
         "232.10072.27": null,
         "232.10072.28": null,
+        "232.10072.31": null,
+        "232.10072.32": null,
         "232.9921.42": null,
-        "232.9921.55": null,
         "232.9921.83": null,
-        "232.9921.89": null,
         "233.8264.22": null
       },
       "name": "kotlin"
@@ -87,14 +87,14 @@
       ],
       "builds": {
         "223.8836.1185": null,
-        "232.10072.15": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
-        "232.10072.21": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
-        "232.10072.27": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
-        "232.10072.28": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
+        "232.10072.15": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
+        "232.10072.21": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
+        "232.10072.27": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
+        "232.10072.28": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
         "232.9921.42": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
         "232.9921.83": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
         "233.8264.22": "https://plugins.jetbrains.com/files/6981/407738/ini-233.8264.9.zip"
       },
       "name": "ini"
@@ -105,8 +105,8 @@
         "phpstorm"
       ],
       "builds": {
-        "232.10072.27": "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip"
+        "232.10072.27": "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip"
       },
       "name": "symfony-support"
     },
@@ -117,7 +117,7 @@
       ],
       "builds": {
         "232.10072.27": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip"
+        "232.10072.32": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip"
       },
       "name": "php-annotations"
     },
@@ -158,10 +158,10 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
         "232.10072.27": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
         "232.10072.28": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
         "232.9921.42": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
-        "232.9921.83": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip"
+        "232.9921.83": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip"
       },
       "name": "-deprecated-rust"
     },
@@ -186,10 +186,10 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
         "232.10072.27": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
         "232.10072.28": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
         "232.9921.42": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
-        "232.9921.83": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip"
+        "232.9921.83": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip"
       },
       "name": "-deprecated-rust-beta"
     },
@@ -207,7 +207,7 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip",
         "232.10072.27": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip",
         "232.10072.28": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip"
+        "232.10072.31": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip"
       },
       "name": "ide-features-trainer"
     },
@@ -233,10 +233,10 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
         "232.10072.27": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
         "232.10072.28": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
         "232.9921.42": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
         "232.9921.83": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
         "233.8264.22": null
       },
       "name": "nixidea"
@@ -267,16 +267,16 @@
         "webstorm"
       ],
       "builds": {
-        "223.8836.1185": "https://plugins.jetbrains.com/files/10037/358812/CSVEditor-3.2.1-223.zip",
-        "232.10072.15": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
-        "232.10072.21": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
-        "232.10072.27": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
-        "232.10072.28": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
-        "232.9921.42": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
-        "232.9921.83": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
-        "233.8264.22": "https://plugins.jetbrains.com/files/10037/243092/CSV-2.21.0.zip"
+        "223.8836.1185": "https://plugins.jetbrains.com/files/10037/417700/CSVEditor-3.2.2-223.zip",
+        "232.10072.15": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+        "232.10072.21": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+        "232.10072.27": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+        "232.10072.28": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+        "232.9921.42": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+        "232.9921.83": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+        "233.8264.22": "https://plugins.jetbrains.com/files/10037/417702/CSVEditor-3.2.2-233.zip"
       },
       "name": "csv-editor"
     },
@@ -302,10 +302,10 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
         "232.10072.27": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
         "232.10072.28": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
         "232.9921.42": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
         "232.9921.83": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
         "233.8264.22": "https://plugins.jetbrains.com/files/12062/405118/keymap-vscode-233.8264.3.zip"
       },
       "name": "vscode-keymap"
@@ -332,10 +332,10 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
         "232.10072.27": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
         "232.10072.28": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
         "232.9921.42": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
         "232.9921.83": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
         "233.8264.22": "https://plugins.jetbrains.com/files/12559/405631/keymap-eclipse-233.8264.9.zip"
       },
       "name": "eclipse-keymap"
@@ -362,10 +362,10 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
         "232.10072.27": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
         "232.10072.28": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
         "232.9921.42": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
         "232.9921.83": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
         "233.8264.22": "https://plugins.jetbrains.com/files/13017/405636/keymap-visualStudio-233.8264.9.zip"
       },
       "name": "visual-studio-keymap"
@@ -392,10 +392,10 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
         "232.10072.27": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
         "232.10072.28": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
+        "232.10072.31": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
+        "232.10072.32": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
         "232.9921.42": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
-        "232.9921.55": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
         "232.9921.83": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
-        "232.9921.89": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
         "233.8264.22": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar"
       },
       "name": "darcula-pitch-black"
@@ -422,10 +422,10 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
         "232.10072.27": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
         "232.10072.28": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
         "232.9921.42": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
         "232.9921.83": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
         "233.8264.22": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip"
       },
       "name": "github-copilot"
@@ -452,10 +452,10 @@
         "232.10072.21": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
         "232.10072.27": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
         "232.10072.28": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
+        "232.10072.31": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
+        "232.10072.32": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
         "232.9921.42": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
-        "232.9921.55": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
         "232.9921.83": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
-        "232.9921.89": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
         "233.8264.22": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip"
       },
       "name": "netbeans-6-5-keymap"
@@ -475,9 +475,9 @@
     }
   },
   "files": {
-    "https://plugins.jetbrains.com/files/10037/243092/CSV-2.21.0.zip": "sha256-Mfo8z2pjn+Gk1uumw5xpZQwpkqLRVqAu2Z07zjn2N1M=",
-    "https://plugins.jetbrains.com/files/10037/358812/CSVEditor-3.2.1-223.zip": "sha256-l8xq7XXQheZYcP+kdnLXAO7FhfPJYwIh+ZffbttBI9s=",
-    "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip": "sha256-m9ocJSFWparZLrX1MQA0IlSH5LHodmzzVmGZ6eHml24=",
+    "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip": "sha256-3bHSRhzvVO07mvuD6tpkiKFXTF66zCK/wpXFVb8IkfY=",
+    "https://plugins.jetbrains.com/files/10037/417700/CSVEditor-3.2.2-223.zip": "sha256-4Y/DZpCWKljaslJFsaqItq1DVJVVRlQjWpM6GLRo8QA=",
+    "https://plugins.jetbrains.com/files/10037/417702/CSVEditor-3.2.2-233.zip": "sha256-n4psF9fFFU8ohtbOndRx6i20EntjEzL3BvMObAZyOOw=",
     "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip": "sha256-q5i1eAANK+6uBYrtioKLzvJf5ALUB0K4d31Ut0vT/lE=",
     "https://plugins.jetbrains.com/files/12062/405118/keymap-vscode-233.8264.3.zip": "sha256-cB3DTeWhDgAwHlxwYogd0/DuYBzo5DqaRtBvEC/p8I4=",
     "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip": "sha256-eRCsivZbDNrc+kesa9jVsOoMFFz+WpYfSMXxPCCjWjw=",
@@ -495,7 +495,8 @@
     "https://plugins.jetbrains.com/files/6954/381727/kotlin-plugin-223-1.9.10-release-459-IJ8836.35.zip": "sha256-gHkNQyWh6jtY1986aI7Qo6ZNrniPy+Yq4XLLA0pKJkA=",
     "https://plugins.jetbrains.com/files/6981/407738/ini-233.8264.9.zip": "sha256-E3xWjwTxtLkOtm9748BbkKGaS4l8SlZOkj3w6VgqlFQ=",
     "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip": "sha256-XIdhTQMxl/nJnntfQlHLlcyA79IS3hnGEGrXhKBFgY0=",
-    "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip": "sha256-O4ARifSoeL5kXnFQTs6YoLcJvdg5VHks5LIgnwwUAeQ=",
+    "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip": "sha256-eC5Zs6ph/4C3Xf6e07DfyqhBmsG3bAFLnvae1JiFzpE=",
+    "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip": "sha256-3UxSPvEXXhAf3zYg2H/jja4F5fuDFWQ6SWFRvcWJ0Iw=",
     "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip": "sha256-hT5K4w4lhvNwDzDMDSvsIDGj9lyaRqglfOhlbNdqpWs=",
     "https://plugins.jetbrains.com/files/7322/401058/python-ce-232.9921.77.zip": "sha256-cr4LxSz8xVzC+Zm+6LnWGLbF6aGBVLW56crCIQOawhc=",
     "https://plugins.jetbrains.com/files/7322/405773/python-ce-233.8264.8.zip": "sha256-LjN0BkcnX8mVHh2dPULddVwooi9fcABkrRVhTPA7XSo=",
diff --git a/nixpkgs/pkgs/applications/editors/jetbrains/versions.json b/nixpkgs/pkgs/applications/editors/jetbrains/versions.json
index c95feebdb674..5bbbd9dfc7b6 100644
--- a/nixpkgs/pkgs/applications/editors/jetbrains/versions.json
+++ b/nixpkgs/pkgs/applications/editors/jetbrains/versions.json
@@ -67,27 +67,27 @@
     "phpstorm": {
       "update-channel": "PhpStorm RELEASE",
       "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}.tar.gz",
-      "version": "2023.2.2",
-      "sha256": "5e3dd021b82dcad0f51bded677aa87680dcc3f5d843951c48848a9191141bf1d",
-      "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2.tar.gz",
-      "build_number": "232.9921.55",
+      "version": "2023.2.3",
+      "sha256": "dd8d771508b277ab2a713b8f546c2ec6dbb261ba8c23072e46ec6ce2ea9ab2a0",
+      "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3.tar.gz",
+      "build_number": "232.10072.32",
       "version-major-minor": "2022.3"
     },
     "pycharm-community": {
       "update-channel": "PyCharm RELEASE",
       "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}.tar.gz",
-      "version": "2023.2.2",
-      "sha256": "2bb4f73d041b818a7b631feb3fee77036de764543c669efe9cf6766510a68e3f",
-      "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2.tar.gz",
-      "build_number": "232.9921.89"
+      "version": "2023.2.3",
+      "sha256": "d59dd88c1eb51cdd756433d415588c573ca944ebf6f08844b8ac8cd2e3d9937b",
+      "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3.tar.gz",
+      "build_number": "232.10072.31"
     },
     "pycharm-professional": {
       "update-channel": "PyCharm RELEASE",
       "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}.tar.gz",
-      "version": "2023.2.2",
-      "sha256": "f7263b17e2456efcb5efab1eac53aafb6a0be1a7f9fbf25a419c9d7b447f6ded",
-      "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2.tar.gz",
-      "build_number": "232.9921.89"
+      "version": "2023.2.3",
+      "sha256": "e625fea80b72c9e12f986a8eb918425c6ef1d3f7b31117b40d122e3ce76046b1",
+      "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3.tar.gz",
+      "build_number": "232.10072.31"
     },
     "rider": {
       "update-channel": "Rider RELEASE",
@@ -190,27 +190,27 @@
     "phpstorm": {
       "update-channel": "PhpStorm RELEASE",
       "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}-aarch64.tar.gz",
-      "version": "2023.2.2",
-      "sha256": "b3067ffa32fab0880ffce8dff000d463b86bef9b30f53fc4d41f5d4e518c7528",
-      "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2-aarch64.tar.gz",
-      "build_number": "232.9921.55",
+      "version": "2023.2.3",
+      "sha256": "577bea15c1208e0b842bcdb2ff0f0205144a8800fcadf87f873af7c067e0ce73",
+      "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3-aarch64.tar.gz",
+      "build_number": "232.10072.32",
       "version-major-minor": "2022.3"
     },
     "pycharm-community": {
       "update-channel": "PyCharm RELEASE",
       "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}-aarch64.tar.gz",
-      "version": "2023.2.2",
-      "sha256": "7d15908f9261ee7905b61d83d4a048fee1e3a2fea9465ada1fc459b2ea0e4d5f",
-      "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2-aarch64.tar.gz",
-      "build_number": "232.9921.89"
+      "version": "2023.2.3",
+      "sha256": "6fdc5238ffa4767834b11b52b650107f1c64d6a53d0e2bbc23581b6c90b67ab5",
+      "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3-aarch64.tar.gz",
+      "build_number": "232.10072.31"
     },
     "pycharm-professional": {
       "update-channel": "PyCharm RELEASE",
       "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}-aarch64.tar.gz",
-      "version": "2023.2.2",
-      "sha256": "2cf259859847f7a979565f31faa60148d571206c78c9309dcdf867b76c16ef25",
-      "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2-aarch64.tar.gz",
-      "build_number": "232.9921.89"
+      "version": "2023.2.3",
+      "sha256": "578ecbd059ccb010682cf602e959454b296ec2e741202f236fbdb38897b296dd",
+      "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3-aarch64.tar.gz",
+      "build_number": "232.10072.31"
     },
     "rider": {
       "update-channel": "Rider RELEASE",
@@ -313,27 +313,27 @@
     "phpstorm": {
       "update-channel": "PhpStorm RELEASE",
       "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}.dmg",
-      "version": "2023.2.2",
-      "sha256": "99a9bb313a5c141ecd1810306deaca3cf52d338edf206362b3f9d9337a27890e",
-      "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2.dmg",
-      "build_number": "232.9921.55",
+      "version": "2023.2.3",
+      "sha256": "7ce4ff6b344ff8ce18ef8a821ba3fd1d222f9222a9b3e65744a796379d92417e",
+      "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3.dmg",
+      "build_number": "232.10072.32",
       "version-major-minor": "2022.3"
     },
     "pycharm-community": {
       "update-channel": "PyCharm RELEASE",
       "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}.dmg",
-      "version": "2023.2.2",
-      "sha256": "f482b6d451efec897764487b116f7bf09d507a5ebfb841c33e2abd2441c3b3a7",
-      "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2.dmg",
-      "build_number": "232.9921.89"
+      "version": "2023.2.3",
+      "sha256": "b914bd3c0018f951bef5da9c04907355a88546ce983dcf4115bbf11556015ec7",
+      "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3.dmg",
+      "build_number": "232.10072.31"
     },
     "pycharm-professional": {
       "update-channel": "PyCharm RELEASE",
       "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}.dmg",
-      "version": "2023.2.2",
-      "sha256": "830f590d63199b389bbaa955c8602fa027bc1eb25bd8ce5636474eec72745b58",
-      "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2.dmg",
-      "build_number": "232.9921.89"
+      "version": "2023.2.3",
+      "sha256": "b33bbd30222363cdc3091aee923ed1c309edba799616a3a681cd9a1ca94e822a",
+      "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3.dmg",
+      "build_number": "232.10072.31"
     },
     "rider": {
       "update-channel": "Rider RELEASE",
@@ -436,27 +436,27 @@
     "phpstorm": {
       "update-channel": "PhpStorm RELEASE",
       "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}-aarch64.dmg",
-      "version": "2023.2.2",
-      "sha256": "a31daeddae532324436b2d11acbd5fb657721883f17c7ef4457ac76a51bd4189",
-      "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2-aarch64.dmg",
-      "build_number": "232.9921.55",
+      "version": "2023.2.3",
+      "sha256": "68d543fb2a79cd0b07ddb94a4c00d8c0c1aca7f604bc838ac92e232e763489b3",
+      "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3-aarch64.dmg",
+      "build_number": "232.10072.32",
       "version-major-minor": "2022.3"
     },
     "pycharm-community": {
       "update-channel": "PyCharm RELEASE",
       "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}-aarch64.dmg",
-      "version": "2023.2.2",
-      "sha256": "2bcddf3e58902578745dd1803f17ebd18f4c98dc76bf48b0945afbc7bae45832",
-      "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2-aarch64.dmg",
-      "build_number": "232.9921.89"
+      "version": "2023.2.3",
+      "sha256": "08c45adbb0dca219955f511993ca8150dcca235bdba3ac24c67ae035c68ba992",
+      "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3-aarch64.dmg",
+      "build_number": "232.10072.31"
     },
     "pycharm-professional": {
       "update-channel": "PyCharm RELEASE",
       "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}-aarch64.dmg",
-      "version": "2023.2.2",
-      "sha256": "5d4292dd0e40db35199ebcd6472d4b46c505d3357d2324690338758355e0f092",
-      "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2-aarch64.dmg",
-      "build_number": "232.9921.89"
+      "version": "2023.2.3",
+      "sha256": "63d68b20963575f76937ca0ce18a8150639c47b8cf8f3d6e96fa3306191cd076",
+      "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3-aarch64.dmg",
+      "build_number": "232.10072.31"
     },
     "rider": {
       "update-channel": "Rider RELEASE",
diff --git a/nixpkgs/pkgs/applications/editors/neovim/neovim-gtk.nix b/nixpkgs/pkgs/applications/editors/neovim/neovim-gtk.nix
index eebb980f85cb..eebb980f85cb 100755..100644
--- a/nixpkgs/pkgs/applications/editors/neovim/neovim-gtk.nix
+++ b/nixpkgs/pkgs/applications/editors/neovim/neovim-gtk.nix
diff --git a/nixpkgs/pkgs/applications/editors/pulsar/default.nix b/nixpkgs/pkgs/applications/editors/pulsar/default.nix
index d2162dc9c9ef..ef08ac9352dd 100644
--- a/nixpkgs/pkgs/applications/editors/pulsar/default.nix
+++ b/nixpkgs/pkgs/applications/editors/pulsar/default.nix
@@ -209,5 +209,14 @@ stdenv.mkDerivation rec {
     license = licenses.mit;
     platforms = platforms.linux;
     maintainers = with maintainers; [ colamaroro ];
+    knownVulnerabilities = [
+      "CVE-2023-5217"
+      "CVE-2022-21718"
+      "CVE-2022-29247"
+      "CVE-2022-29257"
+      "CVE-2022-36077"
+      "CVE-2023-29198"
+      "CVE-2023-39956"
+    ];
   };
 }
diff --git a/nixpkgs/pkgs/applications/editors/texmacs/default.nix b/nixpkgs/pkgs/applications/editors/texmacs/default.nix
index 427d0aa3ace8..00372c1cab8b 100644
--- a/nixpkgs/pkgs/applications/editors/texmacs/default.nix
+++ b/nixpkgs/pkgs/applications/editors/texmacs/default.nix
@@ -1,5 +1,5 @@
-{ lib, mkDerivation, callPackage, fetchurl,
-  guile_1_8, qtbase, xmodmap, which, freetype,
+{ lib, stdenv, callPackage, fetchurl,
+  guile_1_8, xmodmap, which, freetype,
   libjpeg,
   sqlite,
   tex ? null,
@@ -8,6 +8,11 @@
   python3 ? null,
   cmake,
   pkg-config,
+  wrapQtAppsHook,
+  xdg-utils,
+  qtbase,
+  qtsvg,
+  qtmacextras,
   ghostscriptX ? null,
   extraFonts ? false,
   chineseFonts ? false,
@@ -15,32 +20,49 @@
   koreanFonts ? false }:
 
 let
-  pname = "TeXmacs";
-  version = "2.1";
+  pname = "texmacs";
+  version = "2.1.2";
   common = callPackage ./common.nix {
     inherit tex extraFonts chineseFonts japaneseFonts koreanFonts;
   };
 in
-mkDerivation {
+stdenv.mkDerivation {
   inherit pname version;
 
   src = fetchurl {
     url = "https://www.texmacs.org/Download/ftp/tmftp/source/TeXmacs-${version}-src.tar.gz";
-    sha256 = "1gl6k1bwrk1y7hjyl4xvlqvmk5crl4jvsk8wrfp7ynbdin6n2i48";
+    hash = "sha256-Ds9gxOwMYSttEWrawgxLHGxHyMBvt8WmyPIwBP2g/CM=";
   };
 
-  nativeBuildInputs = [ cmake pkg-config ];
+  postPatch = common.postPatch + ''
+    substituteInPlace configure \
+      --replace "-mfpmath=sse -msse2" ""
+  '';
+
+  nativeBuildInputs = [
+    guile_1_8
+    pkg-config
+    wrapQtAppsHook
+    xdg-utils
+  ] ++ lib.optionals (!stdenv.isDarwin) [
+    cmake
+  ];
+
   buildInputs = [
     guile_1_8
     qtbase
+    qtsvg
     ghostscriptX
     freetype
     libjpeg
     sqlite
     git
     python3
+  ] ++ lib.optionals stdenv.isDarwin [
+    qtmacextras
   ];
-  NIX_LDFLAGS = "-lz";
+
+  env.NIX_LDFLAGS = "-lz";
 
   qtWrapperArgs = [
     "--suffix" "PATH" ":" (lib.makeBinPath [
@@ -58,10 +80,8 @@ mkDerivation {
     wrapQtApp $out/bin/texmacs
   '';
 
-  inherit (common) postPatch;
-
   meta = common.meta // {
     maintainers = [ lib.maintainers.roconnor ];
-    platforms = lib.platforms.gnu ++ lib.platforms.linux;  # arbitrary choice
+    platforms = lib.platforms.all;
   };
 }
diff --git a/nixpkgs/pkgs/applications/editors/vim/plugins/generated.nix b/nixpkgs/pkgs/applications/editors/vim/plugins/generated.nix
index ecd22ae6102b..a38f9c137edc 100644
--- a/nixpkgs/pkgs/applications/editors/vim/plugins/generated.nix
+++ b/nixpkgs/pkgs/applications/editors/vim/plugins/generated.nix
@@ -3333,6 +3333,18 @@ final: prev:
     meta.homepage = "https://github.com/wincent/ferret/";
   };
 
+  ferris-nvim = buildNeovimPlugin {
+    pname = "ferris.nvim";
+    version = "2023-11-21";
+    src = fetchFromGitHub {
+      owner = "mrcjkb";
+      repo = "ferris.nvim";
+      rev = "54943eaeb0d4534988d2378936052655c988c3c2";
+      sha256 = "o4yY4IHYBCnanfy7dx/wGdiPFMLMKZsYrG2SqlPRvdI=";
+    };
+    meta.homepage = "https://github.com/mrcjkb/ferris.nvim/";
+  };
+
   fidget-nvim = buildVimPlugin {
     pname = "fidget.nvim";
     version = "2023-06-10";
diff --git a/nixpkgs/pkgs/applications/editors/vim/plugins/vim-plugin-names b/nixpkgs/pkgs/applications/editors/vim/plugins/vim-plugin-names
index ab353da48e24..828465764408 100644
--- a/nixpkgs/pkgs/applications/editors/vim/plugins/vim-plugin-names
+++ b/nixpkgs/pkgs/applications/editors/vim/plugins/vim-plugin-names
@@ -277,6 +277,7 @@ https://github.com/freddiehaddad/feline.nvim/,,
 https://github.com/bakpakin/fennel.vim/,,
 https://github.com/lambdalisue/fern.vim/,,
 https://github.com/wincent/ferret/,,
+https://github.com/mrcjkb/ferris.nvim/,HEAD,
 https://github.com/j-hui/fidget.nvim/,legacy,
 https://github.com/bogado/file-line/,,
 https://github.com/glacambre/firenvim/,HEAD,
diff --git a/nixpkgs/pkgs/applications/editors/vscode/extensions/default.nix b/nixpkgs/pkgs/applications/editors/vscode/extensions/default.nix
index c0d3415713fc..fb6e709bba20 100644
--- a/nixpkgs/pkgs/applications/editors/vscode/extensions/default.nix
+++ b/nixpkgs/pkgs/applications/editors/vscode/extensions/default.nix
@@ -326,8 +326,8 @@ let
         mktplcRef = {
           name = "astro-vscode";
           publisher = "astro-build";
-          version = "2.1.1";
-          sha256 = "sha256-UVZOpkOHbLiwA4VfTgXxuIU8EtJLnqRa5zUVha6xQJY=";
+          version = "2.3.3";
+          sha256 = "sha256-A7+7lnCPAtSWUfHLNKbYqKuTxi2Nx05Qdh5HCkT1dnM=";
         };
         meta = {
           changelog = "https://marketplace.visualstudio.com/items/astro-build.astro-vscode/changelog";
diff --git a/nixpkgs/pkgs/applications/emulators/yuzu/generic.nix b/nixpkgs/pkgs/applications/emulators/yuzu/generic.nix
index 3fdd6db84661..a24ded852531 100644
--- a/nixpkgs/pkgs/applications/emulators/yuzu/generic.nix
+++ b/nixpkgs/pkgs/applications/emulators/yuzu/generic.nix
@@ -49,10 +49,10 @@
 }:
 
 let
-  tzinfoVersion = "220816";
+  tzinfoVersion = "221202";
   tzinfo = fetchurl {
     url = "https://github.com/lat9nq/tzdb_to_nx/releases/download/${tzinfoVersion}/${tzinfoVersion}.zip";
-    hash = "sha256-yv8ykEYPu9upeXovei0u16iqQ7NasH6873KnQy4+KwI=";
+    hash = "sha256-mRzW+iIwrU1zsxHmf+0RArU8BShAoEMvCz+McXFFK3c=";
   };
 in stdenv.mkDerivation {
   pname = "yuzu-${branch}";
diff --git a/nixpkgs/pkgs/applications/emulators/yuzu/sources.nix b/nixpkgs/pkgs/applications/emulators/yuzu/sources.nix
index fc6d1813afb5..3371bf15c5c9 100644
--- a/nixpkgs/pkgs/applications/emulators/yuzu/sources.nix
+++ b/nixpkgs/pkgs/applications/emulators/yuzu/sources.nix
@@ -1,19 +1,19 @@
 # Generated by ./update.sh - do not update manually!
-# Last updated: 2023-10-07
+# Last updated: 2023-10-20
 {
   compatList = {
-    rev = "156a0a80efc47069ba3360f8a1b268a1c6f2f505";
+    rev = "9d17cbd71408476c6a28cbf0fa8177155c511681";
     hash = "sha256:1hdsza3wf9a0yvj6h55gsl7xqvhafvbz1i8paz9kg7l49b0gnlh1";
   };
 
   mainline = {
-    version = "1579";
-    hash = "sha256:0689w42as1di8xbh8kq2p0cws8gdwq64zdj3i8wq612nkw0q5s60";
+    version = "1595";
+    hash = "sha256:09b0w6z4w9z4ms2pvik2vrmklfcx25jxcgs61bff3nflilnw9m97";
   };
 
   ea = {
-    version = "3911";
-    distHash = "sha256:0xj642kjhj0gp9l15b3ysj3gmyy47rcvzw9amghsfl13bg5ffnwh";
-    fullHash = "sha256:13rd6kwnhpvjzp67k6pqgl9fsqzwy5d8043hv6kd93gg8jbxkp38";
+    version = "3940";
+    distHash = "sha256:0g0vv274sh3iy56n7s324km87g302005ahi9zh2qhwkiirbnc811";
+    fullHash = "sha256:0ywppc4z5d4b1zl1cr8yfnba58hgi0z2szficwpinapai7q0pyid";
   };
 }
diff --git a/nixpkgs/pkgs/applications/graphics/structorizer/default.nix b/nixpkgs/pkgs/applications/graphics/structorizer/default.nix
index d1f796e42fee..d1f796e42fee 100755..100644
--- a/nixpkgs/pkgs/applications/graphics/structorizer/default.nix
+++ b/nixpkgs/pkgs/applications/graphics/structorizer/default.nix
diff --git a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/default.nix b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/default.nix
index 60b835c719b5..1a0e90546bec 100644
--- a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/default.nix
+++ b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/default.nix
@@ -11,13 +11,13 @@
 buildDotnetModule rec {
   pname = "ArchiSteamFarm";
   # nixpkgs-update: no auto update
-  version = "5.4.9.3";
+  version = "5.4.12.5";
 
   src = fetchFromGitHub {
     owner = "JustArchiNET";
     repo = "ArchiSteamFarm";
     rev = version;
-    hash = "sha256-Yp8hnMIeV+ZHY6yISJdFd1yAQipQsU5vcXgxFDvkGnA=";
+    hash = "sha256-iIYA9BnHUfsB4J7VbSLKaRdJHMW/xULJxKfv8atfAd8=";
   };
 
   dotnet-runtime = dotnetCorePackages.aspnetcore_7_0;
@@ -77,6 +77,7 @@ buildDotnetModule rec {
     homepage = "https://github.com/JustArchiNET/ArchiSteamFarm";
     license = licenses.asl20;
     platforms = [ "x86_64-linux" "aarch64-linux" ];
+    mainProgram = "ArchiSteamFarm";
     maintainers = with maintainers; [ SuperSandro2000 lom ];
   };
 }
diff --git a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/deps.nix b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/deps.nix
index 5d353bfdf6b8..6154d1ca6e2d 100644
--- a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/deps.nix
+++ b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/deps.nix
@@ -57,11 +57,11 @@
   (fetchNuGet { pname = "Humanizer.Core.zh-Hans"; version = "2.14.1"; sha256 = "0zn99311zfn602phxyskfjq9vly0w5712z6fly8r4q0h94qa8c85"; })
   (fetchNuGet { pname = "Humanizer.Core.zh-Hant"; version = "2.14.1"; sha256 = "0qxjnbdj645l5sd6y3100yyrq1jy5misswg6xcch06x8jv7zaw1p"; })
   (fetchNuGet { pname = "JetBrains.Annotations"; version = "2023.2.0"; sha256 = "0nx7nrzbg9gk9skdc9x330cbr5xbsly6z9gzxm46vywf55yp8vaj"; })
-  (fetchNuGet { pname = "Markdig.Signed"; version = "0.32.0"; sha256 = "0rc1d8pwypq44pr15wn8g52zbqz70swdrdmjlzccf6zvwy1vyqkc"; })
+  (fetchNuGet { pname = "Markdig.Signed"; version = "0.33.0"; sha256 = "0816lmn0varxwhdklhh5hdqp0xnfz3nlrvaf2wpkk5v1mq86216h"; })
   (fetchNuGet { pname = "Microsoft.AspNetCore.JsonPatch"; version = "7.0.0"; sha256 = "1f13vsfs1rp9bmdp3khk4mk2fif932d72yxm2wszpsr239x4s2bf"; })
   (fetchNuGet { pname = "Microsoft.AspNetCore.Mvc.NewtonsoftJson"; version = "7.0.0"; sha256 = "1w49rg0n5wb1m5wnays2mmym7qy7bsi2b1zxz97af2rkbw3s3hbd"; })
   (fetchNuGet { pname = "Microsoft.Bcl.AsyncInterfaces"; version = "6.0.0"; sha256 = "15gqy2m14fdlvy1g59207h5kisznm355kbw010gy19vh47z8gpz3"; })
-  (fetchNuGet { pname = "Microsoft.CodeCoverage"; version = "17.7.0"; sha256 = "12m9fay2d7jvj00hfpws37vflpqvz4dy4gcm25bjycg1zyfpzvly"; })
+  (fetchNuGet { pname = "Microsoft.CodeCoverage"; version = "17.7.2"; sha256 = "09mf5kpxn1a1m8ciwklhh6ascx0yqpcs5r2hvmfj80j44n3qrwhm"; })
   (fetchNuGet { pname = "Microsoft.CSharp"; version = "4.7.0"; sha256 = "0gd67zlw554j098kabg887b5a6pq9kzavpa3jjy5w53ccjzjfy8j"; })
   (fetchNuGet { pname = "Microsoft.Extensions.ApiDescription.Server"; version = "6.0.5"; sha256 = "1pi2bm3cm0a7jzqzmfc2r7bpcdkmk3hhjfvb2c81j7wl7xdw3624"; })
   (fetchNuGet { pname = "Microsoft.Extensions.Configuration.Abstractions"; version = "6.0.0"; sha256 = "0w6wwxv12nbc3sghvr68847wc9skkdgsicrz3fx4chgng1i3xy0j"; })
@@ -71,11 +71,15 @@
   (fetchNuGet { pname = "Microsoft.Extensions.Logging.Abstractions"; version = "6.0.0"; sha256 = "0b75fmins171zi6bfdcq1kcvyrirs8n91mknjnxy4c3ygi1rrnj0"; })
   (fetchNuGet { pname = "Microsoft.Extensions.Options"; version = "6.0.0"; sha256 = "008pnk2p50i594ahz308v81a41mbjz9mwcarqhmrjpl2d20c868g"; })
   (fetchNuGet { pname = "Microsoft.Extensions.Primitives"; version = "6.0.0"; sha256 = "1kjiw6s4yfz9gm7mx3wkhp06ghnbs95icj9hi505shz9rjrg42q2"; })
-  (fetchNuGet { pname = "Microsoft.NET.Test.Sdk"; version = "17.7.0"; sha256 = "1srhqqmnf9pxdbpffr7dh0bihhf09d0iq5g6gh8ql7brfrh99lvb"; })
+  (fetchNuGet { pname = "Microsoft.IdentityModel.Abstractions"; version = "7.0.3"; sha256 = "0njmg2lygnirnfjv9gck2f5lq4ly5rgws9cpf8qj3kwcwxfp0b9s"; })
+  (fetchNuGet { pname = "Microsoft.IdentityModel.JsonWebTokens"; version = "7.0.3"; sha256 = "1ayh85xqdq8rqjk2iqcn7iaczcl7d8qg6bxk0b4rgx59fmsmbqj7"; })
+  (fetchNuGet { pname = "Microsoft.IdentityModel.Logging"; version = "7.0.3"; sha256 = "13cjqmf59k895q6gkd5ycl89mnpalckda7rhsdl11jdyr32hsfnv"; })
+  (fetchNuGet { pname = "Microsoft.IdentityModel.Tokens"; version = "7.0.3"; sha256 = "1pmhd0imh9wlhvbvvwjrpjsqvzagi2ly22nddwr4r0pi234khyz1"; })
+  (fetchNuGet { pname = "Microsoft.NET.Test.Sdk"; version = "17.7.2"; sha256 = "08g9dpp766racnh90s1sy3ncl291majgq6v2604hfw1f6zkmbjqh"; })
   (fetchNuGet { pname = "Microsoft.NETCore.Platforms"; version = "5.0.0"; sha256 = "0mwpwdflidzgzfx2dlpkvvnkgkr2ayaf0s80737h4wa35gaj11rc"; })
   (fetchNuGet { pname = "Microsoft.OpenApi"; version = "1.2.3"; sha256 = "07b19k89whj69j87afkz86gp9b3iybw8jqwvlgcn43m7fb2y99rr"; })
-  (fetchNuGet { pname = "Microsoft.TestPlatform.ObjectModel"; version = "17.7.0"; sha256 = "1sqmk99644fx66zk2qa2ims1zl6741i3wl4rjh4z6jakd4xbc28i"; })
-  (fetchNuGet { pname = "Microsoft.TestPlatform.TestHost"; version = "17.7.0"; sha256 = "1s8ap0ljqssbqp1ilgsidjr948b9szf1cbl3fgl6smxig9im4zrl"; })
+  (fetchNuGet { pname = "Microsoft.TestPlatform.ObjectModel"; version = "17.7.2"; sha256 = "0xdjkdnrvnaxqgg38y5w1l3jbppigg68cc8q9jn0p21vn48bgrxq"; })
+  (fetchNuGet { pname = "Microsoft.TestPlatform.TestHost"; version = "17.7.2"; sha256 = "1szsg1iy77f0caxzkk0ihpp4ifbfnbdbn8k0wbbhbdprxj8pr356"; })
   (fetchNuGet { pname = "Microsoft.Win32.Registry"; version = "5.0.0"; sha256 = "102hvhq2gmlcbq8y2cb7hdr2dnmjzfp2k3asr1ycwrfacwyaak7n"; })
   (fetchNuGet { pname = "MSTest.TestAdapter"; version = "3.1.1"; sha256 = "0y3ic8jv5jhld6gan2qfa2wyk4z57f7y4y5a47njr0jvxxnarg2c"; })
   (fetchNuGet { pname = "MSTest.TestFramework"; version = "3.1.1"; sha256 = "1lbgkrbrkmw4c54g61cwbmwc4zl8hyqmp283ymvj93lq7chbxasn"; })
@@ -86,9 +90,9 @@
   (fetchNuGet { pname = "Nito.AsyncEx.Tasks"; version = "5.1.2"; sha256 = "11wp47kc69sjdxrbg5pgx0wlffqlp0x5kr54ggnz2v19kmjz362v"; })
   (fetchNuGet { pname = "Nito.Collections.Deque"; version = "1.1.1"; sha256 = "152564q3s0n5swfv5p5rx0ghn2sm0g2xsnbd7gv8vb9yfklv7yg8"; })
   (fetchNuGet { pname = "Nito.Disposables"; version = "2.2.1"; sha256 = "1hx5k8497j34kxxgh060bvij0vfnraw90dmm3h9bmamcdi8wp80l"; })
-  (fetchNuGet { pname = "NLog"; version = "5.2.3"; sha256 = "0srai3s2kk9y2jimdvw1xw86nch38q6nza598dpr81dghx3s6j6w"; })
-  (fetchNuGet { pname = "NLog.Extensions.Logging"; version = "5.3.3"; sha256 = "0j19fljxbcc0bysmj7i0fmiax6sp5kjapf2llkimv7dh63rj9ckg"; })
-  (fetchNuGet { pname = "NLog.Web.AspNetCore"; version = "5.3.3"; sha256 = "0rhha2lwrzwlx0q1a8w9ph9xwayl3kmmy200ygsghcd02srlazkj"; })
+  (fetchNuGet { pname = "NLog"; version = "5.2.5"; sha256 = "02fybqi9d7czz3jmhmgb8wia2hpjj5hmcnij6zsgs69rkv6hf9j0"; })
+  (fetchNuGet { pname = "NLog.Extensions.Logging"; version = "5.3.5"; sha256 = "0jzfqa12l5vvxd2j684cnm29w19v386cpm11pw8h6prpf57affaj"; })
+  (fetchNuGet { pname = "NLog.Web.AspNetCore"; version = "5.3.5"; sha256 = "0li0sw04w0a4zms5jjv1ga45wxiqlcvaw8gi0wbhiifrdzz5yckb"; })
   (fetchNuGet { pname = "NuGet.Frameworks"; version = "6.5.0"; sha256 = "0s37d1p4md0k6d4cy6sq36f2dgkd9qfbzapxhkvi8awwh0vrynhj"; })
   (fetchNuGet { pname = "protobuf-net"; version = "3.2.16"; sha256 = "0pwlqlq2p8my2sr8b0cvdav5cm8wpwf3s4gy7s1ba701ac2zyb9y"; })
   (fetchNuGet { pname = "protobuf-net.Core"; version = "3.2.16"; sha256 = "00znhikq7valr3jaxg66cwli9hf75wkmmpf6rf8p790hf8lxq0c5"; })
@@ -108,6 +112,7 @@
   (fetchNuGet { pname = "System.Composition.Runtime"; version = "7.0.0"; sha256 = "1p9xpqzx42s8cdizv6nh15hcjvl2km0rwby66nfkj4cb472l339s"; })
   (fetchNuGet { pname = "System.Composition.TypedParts"; version = "7.0.0"; sha256 = "0syz7y6wgnxxgjvfqgymn9mnaa5fjy1qp06qnsvh3agr9mvcv779"; })
   (fetchNuGet { pname = "System.Diagnostics.DiagnosticSource"; version = "6.0.0"; sha256 = "0rrihs9lnb1h6x4h0hn6kgfnh58qq7hx8qq99gh6fayx4dcnx3s5"; })
+  (fetchNuGet { pname = "System.IdentityModel.Tokens.Jwt"; version = "7.0.3"; sha256 = "1fls88ffq34j1gr6zay1crm27v3sjs5fa4mvj9akqjq05bxanlhk"; })
   (fetchNuGet { pname = "System.Linq.Async"; version = "6.0.1"; sha256 = "10ira8hmv0i54yp9ggrrdm1c06j538sijfjpn1kmnh9j2xk5yzmq"; })
   (fetchNuGet { pname = "System.Reflection.Metadata"; version = "1.6.0"; sha256 = "1wdbavrrkajy7qbdblpbpbalbdl48q3h34cchz24gvdgyrlf15r4"; })
   (fetchNuGet { pname = "System.Runtime.CompilerServices.Unsafe"; version = "6.0.0"; sha256 = "0qm741kh4rh57wky16sq4m0v05fxmkjjr87krycf5vp9f0zbahbc"; })
diff --git a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/update.sh b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/update.sh
index 9af9acb69835..53d3ee664191 100755
--- a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/update.sh
+++ b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/update.sh
@@ -1,5 +1,5 @@
 #!/usr/bin/env nix-shell
-#!nix-shell -I nixpkgs=./. -i bash -p curl gnused jq common-updater-scripts nix-prefetch prefetch-npm-deps
+#!nix-shell -I nixpkgs=./. -i bash -p curl gnused jq common-updater-scripts
 set -euo pipefail
 cd "$(dirname "${BASH_SOURCE[0]}")"
 
@@ -14,7 +14,7 @@ if [[ "$new_version" == "$old_version" ]]; then
 fi
 
 asf_path=$PWD
-pushd ../../../..
+cd ../../../..
 
 if [[ "${1:-}" != "--deps-only" ]]; then
     update-source-version ArchiSteamFarm "$new_version"
@@ -22,5 +22,5 @@ fi
 
 $(nix-build -A ArchiSteamFarm.fetch-deps --no-out-link)
 
-popd
-"$asf_path/web-ui/update.sh"
+cd "$asf_path/web-ui"
+./update.sh
diff --git a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore
new file mode 100644
index 000000000000..d8b83df9cdb6
--- /dev/null
+++ b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore
@@ -0,0 +1 @@
+package-lock.json
diff --git a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix
index 77f4e9c6e299..4dad0b1f5b6b 100644
--- a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix
+++ b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix
@@ -1,19 +1,19 @@
-{ lib, fetchFromGitHub, buildNpmPackage, nodePackages, ArchiSteamFarm }:
+{ lib, fetchFromGitHub, buildNpmPackage, ArchiSteamFarm }:
 
-buildNpmPackage {
+buildNpmPackage rec {
   pname = "asf-ui";
-  inherit (ArchiSteamFarm) version;
+  version = "fceb2fb828cfa420c77dc5cde433fd519a6717d4";
 
   src = fetchFromGitHub {
     owner = "JustArchiNET";
     repo = "ASF-ui";
     # updated by the update script
     # this is always the commit that should be used with asf-ui from the latest asf version
-    rev = "0b812a7ab0d2f01a675d27f80008ad7b6972b4aa";
-    hash = "sha256-ut0x/qT3DyDASW4QbNT+BF6eXHCIbTol5E+3+tirFDA=";
+    rev = version;
+    hash = "sha256-gMQWly7HN5rIV9r72Qa+gHuBuQMs9sh09od4ja4sRGU=";
   };
 
-  npmDepsHash = "sha256-HpBEoAIGejpHJnUciz4iWILcXdgpw7X1xFuXmx9Z9dw=";
+  npmDepsHash = "sha256-UDCQTRpcPDcuvPzlqTu315EkGr5G0+z7qMSsPgYQacA=";
 
   installPhase = ''
     runHook preInstall
diff --git a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh
index 7f026383383d..6fa8e67a1217 100755
--- a/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh
+++ b/nixpkgs/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh
@@ -1,23 +1,19 @@
 #!/usr/bin/env nix-shell
-#! nix-shell -I nixpkgs=../../../.. -i bash -p nodePackages.node2nix gnused jq curl
+#! nix-shell -I nixpkgs=../../../../.. -i bash -p curl gnused jq common-updater-scripts prefetch-npm-deps
 set -eou pipefail
 
-cd "$(dirname "$0")"
-pushd ../../../../..
+cd "$(dirname "$0")"/../../../../..
 version=$(nix-instantiate --strict --eval -A ArchiSteamFarm.version | jq -r)
-popd
-pushd "$(dirname "$0")"
+cd -
 ui=$(curl ${GITHUB_TOKEN:+" -u \":$GITHUB_TOKEN\""} "https://api.github.com/repos/JustArchiNET/ArchiSteamFarm/contents/ASF-ui?ref=$version" | jq -r .sha)
 
 curl "https://raw.githubusercontent.com/JustArchiNET/ASF-ui/$ui/package-lock.json" -o package-lock.json
 
-# update-source-version doesn't work for some reason
-sed -i "s/rev\\s*=\\s*.*/rev = \"$ui\";/" default.nix
-sed -i "s/hash\\s*=\\s*.*/hash = \"$(nix-prefetch fetchurl --url "https://github.com/JustArchiNET/ASF-ui/archive/$ui.tar.gz")\";/" default.nix
+cd -
+update-source-version ArchiSteamFarm.ui "$ui"
+cd -
 
 npmDepsHash=$(prefetch-npm-deps ./package-lock.json)
 sed -E 's#\bnpmDepsHash = ".*?"#npmDepsHash = "'"$npmDepsHash"'"#' -i default.nix
 
 rm package-lock.json
-
-popd
diff --git a/nixpkgs/pkgs/applications/misc/albert/default.nix b/nixpkgs/pkgs/applications/misc/albert/default.nix
index a9008283dd28..ceb74f7b0a32 100644
--- a/nixpkgs/pkgs/applications/misc/albert/default.nix
+++ b/nixpkgs/pkgs/applications/misc/albert/default.nix
@@ -10,6 +10,7 @@
 , qtscxml
 , qtsvg
 , qtdeclarative
+, qtwayland
 , qt5compat
 , wrapQtAppsHook
 , nix-update-script
@@ -42,6 +43,7 @@ stdenv.mkDerivation (finalAttrs: {
     qtscxml
     qtsvg
     qtdeclarative
+    qtwayland
     qt5compat
   ] ++ (with python3Packages; [ python pybind11 ]);
 
diff --git a/nixpkgs/pkgs/applications/misc/blender/default.nix b/nixpkgs/pkgs/applications/misc/blender/default.nix
index 00bbcdafff13..8e7fde6d9c29 100644
--- a/nixpkgs/pkgs/applications/misc/blender/default.nix
+++ b/nixpkgs/pkgs/applications/misc/blender/default.nix
@@ -31,11 +31,11 @@ let
 in
 stdenv.mkDerivation (finalAttrs: rec {
   pname = "blender";
-  version = "3.6.4";
+  version = "3.6.5";
 
   src = fetchurl {
     url = "https://download.blender.org/source/${pname}-${version}.tar.xz";
-    hash = "sha256-zFL0GRWAtNC3C+SAspWZmGa8US92EiYQgVfiOsCJRx4=";
+    hash = "sha256-QAHA/pn22HLsfH6VX4Sp7r25raFxAPS1Gergjez38kM=";
   };
 
   patches = [
diff --git a/nixpkgs/pkgs/applications/misc/dasel/default.nix b/nixpkgs/pkgs/applications/misc/dasel/default.nix
index 04804732edc4..14a8f6013f2b 100644
--- a/nixpkgs/pkgs/applications/misc/dasel/default.nix
+++ b/nixpkgs/pkgs/applications/misc/dasel/default.nix
@@ -6,16 +6,16 @@
 
 buildGoModule rec {
   pname = "dasel";
-  version = "2.3.6";
+  version = "2.4.1";
 
   src = fetchFromGitHub {
     owner = "TomWright";
     repo = "dasel";
     rev = "v${version}";
-    sha256 = "sha256-k+I4n05IbQT7tGzkJ0aPW6kLT1mGqwQOwoKDyal8L3w=";
+    sha256 = "sha256-zxTT/CkSbH40R7itXAx0zD+haHOoMep/W4KfalJQ/8w=";
   };
 
-  vendorHash = "sha256-Gueo8aZS5N1rLqZweXjXv7BLrtShxGDSGfbkYXhy4DQ=";
+  vendorHash = "sha256-CbR0uHtha2OoHW9mcB1I2lGJbjerbZARVN/mTstv/Y0=";
 
   ldflags = [
     "-s" "-w" "-X github.com/tomwright/dasel/v2/internal.Version=${version}"
diff --git a/nixpkgs/pkgs/applications/misc/fluxboxlauncher/default.nix b/nixpkgs/pkgs/applications/misc/fluxboxlauncher/default.nix
index 4794e14b4698..4794e14b4698 100755..100644
--- a/nixpkgs/pkgs/applications/misc/fluxboxlauncher/default.nix
+++ b/nixpkgs/pkgs/applications/misc/fluxboxlauncher/default.nix
diff --git a/nixpkgs/pkgs/applications/misc/get_iplayer/default.nix b/nixpkgs/pkgs/applications/misc/get_iplayer/default.nix
index 2483cc000f01..fe33a7df7569 100644
--- a/nixpkgs/pkgs/applications/misc/get_iplayer/default.nix
+++ b/nixpkgs/pkgs/applications/misc/get_iplayer/default.nix
@@ -11,13 +11,13 @@
 
 perlPackages.buildPerlPackage rec {
   pname = "get_iplayer";
-  version = "3.31";
+  version = "3.33";
 
   src = fetchFromGitHub {
     owner = "get-iplayer";
     repo = "get_iplayer";
     rev = "v${version}";
-    sha256 = "+ChCF27nmPKbqaZVxsZ6TlbzSdEz6RfMs87NE8xaSRw=";
+    hash = "sha256-cX+ydMvpQNFfQICRVKyhnB5gZkVnOMLPbGgdFymzmeA=";
   };
 
   nativeBuildInputs = [ makeWrapper ] ++ lib.optional stdenv.isDarwin shortenPerlShebang;
@@ -32,10 +32,12 @@ perlPackages.buildPerlPackage rec {
 
   installPhase = ''
     runHook preInstall
+
     mkdir -p $out/bin $out/share/man/man1
     cp get_iplayer $out/bin
     wrapProgram $out/bin/get_iplayer --suffix PATH : ${lib.makeBinPath [ atomicparsley ffmpeg ]} --prefix PERL5LIB : $PERL5LIB
     cp get_iplayer.1 $out/share/man/man1
+
     runHook postInstall
   '';
 
diff --git a/nixpkgs/pkgs/applications/misc/nwg-displays/default.nix b/nixpkgs/pkgs/applications/misc/nwg-displays/default.nix
index f0fc2b1bb368..18ba079088af 100644
--- a/nixpkgs/pkgs/applications/misc/nwg-displays/default.nix
+++ b/nixpkgs/pkgs/applications/misc/nwg-displays/default.nix
@@ -14,13 +14,13 @@
 
 python310Packages.buildPythonApplication rec {
   pname = "nwg-displays";
-  version = "0.3.7";
+  version = "0.3.8";
 
   src = fetchFromGitHub {
     owner = "nwg-piotr";
     repo = "nwg-displays";
     rev = "v${version}";
-    hash = "sha256-Y405ZeOSpc1aPKEzFdvlgJgpGAi9HUR+Hvx63uYdp88=";
+    hash = "sha256-9v5TQTliUEnynoGDf1UXsQ9Ym7x2gPmx4QiRJH5BId4=";
   };
 
   nativeBuildInputs = [
diff --git a/nixpkgs/pkgs/applications/misc/nwg-panel/default.nix b/nixpkgs/pkgs/applications/misc/nwg-panel/default.nix
index a4d333e594c3..90864dee69ba 100644
--- a/nixpkgs/pkgs/applications/misc/nwg-panel/default.nix
+++ b/nixpkgs/pkgs/applications/misc/nwg-panel/default.nix
@@ -15,13 +15,13 @@
 
 python3Packages.buildPythonApplication rec {
   pname = "nwg-panel";
-  version = "0.9.13";
+  version = "0.9.14";
 
   src = fetchFromGitHub {
     owner = "nwg-piotr";
     repo = "nwg-panel";
     rev = "v${version}";
-    hash = "sha256-dP/FbMrjPextwedQeLJHM6f/a+EuZ+hQSLrH/rF2XOg=";
+    hash = "sha256-ThcB/BhnJbBHUoRh120iqN6LMGOnkekzALTTgd8uUx4=";
   };
 
   # No tests
diff --git a/nixpkgs/pkgs/applications/misc/obsidian/default.nix b/nixpkgs/pkgs/applications/misc/obsidian/default.nix
index 78967c55a5d7..43ea198d62c9 100644
--- a/nixpkgs/pkgs/applications/misc/obsidian/default.nix
+++ b/nixpkgs/pkgs/applications/misc/obsidian/default.nix
@@ -12,7 +12,7 @@
 let
   inherit (stdenv.hostPlatform) system;
   pname = "obsidian";
-  version = "1.4.14";
+  version = "1.4.16";
   appname = "Obsidian";
   meta = with lib; {
     description = "A powerful knowledge base that works on top of a local folder of plain text Markdown files";
@@ -25,7 +25,7 @@ let
   filename = if stdenv.isDarwin then "Obsidian-${version}-universal.dmg" else "obsidian-${version}.tar.gz";
   src = fetchurl {
     url = "https://github.com/obsidianmd/obsidian-releases/releases/download/v${version}/${filename}";
-    hash = if stdenv.isDarwin then "sha256-5cVKlZJDtXOkil+RohijCcqyJVTrysmqyTvJR0dDAuc=" else "sha256-qFSQer37Nkh3A3oVAFP/0qXzPWJ7SqY2GYA6b1iaYmE=";
+    hash = if stdenv.isDarwin then "sha256-ydLWr+Snkza9G+R7HbPuUdoZsL25Uj+KDos67Mq/urY=" else "sha256-PBKLGs3MZyarSMiWnjqY7d9bQrKu2uLAvLUufpHLxcw=";
   };
 
   icon = fetchurl {
diff --git a/nixpkgs/pkgs/applications/networking/browsers/brave/default.nix b/nixpkgs/pkgs/applications/networking/browsers/brave/default.nix
index 8466850808cb..c3495160029f 100644
--- a/nixpkgs/pkgs/applications/networking/browsers/brave/default.nix
+++ b/nixpkgs/pkgs/applications/networking/browsers/brave/default.nix
@@ -92,11 +92,11 @@ in
 
 stdenv.mkDerivation rec {
   pname = "brave";
-  version = "1.59.117";
+  version = "1.59.120";
 
   src = fetchurl {
     url = "https://github.com/brave/brave-browser/releases/download/v${version}/brave-browser_${version}_amd64.deb";
-    sha256 = "sha256-yckxTKAgglk6YRXist9RZufZdI22iitecmb01NmYPGQ=";
+    sha256 = "sha256-fkIU6XuydF6Bo8V0uS4NObh2fRuKxOWMqVft81uUs9Q=";
   };
 
   dontConfigure = true;
diff --git a/nixpkgs/pkgs/applications/networking/browsers/chromium/common.nix b/nixpkgs/pkgs/applications/networking/browsers/chromium/common.nix
index 22d71e8975f8..72ae7ae6aa41 100644
--- a/nixpkgs/pkgs/applications/networking/browsers/chromium/common.nix
+++ b/nixpkgs/pkgs/applications/networking/browsers/chromium/common.nix
@@ -315,9 +315,6 @@ let
       sed -i -e '/lib_loader.*Load/s!"\(libudev\.so\)!"${lib.getLib systemd}/lib/\1!' \
         device/udev_linux/udev?_loader.cc
     '' + ''
-      sed -i -e '/libpci_loader.*Load/s!"\(libpci\.so\)!"${pciutils}/lib/\1!' \
-        gpu/config/gpu_info_collector_linux.cc
-
       # Allow to put extensions into the system-path.
       sed -i -e 's,/usr,/run/current-system/sw,' chrome/common/chrome_paths.cc
 
@@ -479,9 +476,10 @@ let
 
     postFixup = ''
       # Make sure that libGLESv2 and libvulkan are found by dlopen.
+      # libpci (from pciutils) is needed by dlopen in angle/src/gpu_info_util/SystemInfo_libpci.cpp
       chromiumBinary="$libExecPath/$packageName"
       origRpath="$(patchelf --print-rpath "$chromiumBinary")"
-      patchelf --set-rpath "${lib.makeLibraryPath [ libGL vulkan-loader ]}:$origRpath" "$chromiumBinary"
+      patchelf --set-rpath "${lib.makeLibraryPath [ libGL vulkan-loader pciutils ]}:$origRpath" "$chromiumBinary"
     '';
 
     passthru = {
diff --git a/nixpkgs/pkgs/applications/networking/cluster/eks-node-viewer/default.nix b/nixpkgs/pkgs/applications/networking/cluster/eks-node-viewer/default.nix
index b4f9ce722e79..80538f0f111c 100644
--- a/nixpkgs/pkgs/applications/networking/cluster/eks-node-viewer/default.nix
+++ b/nixpkgs/pkgs/applications/networking/cluster/eks-node-viewer/default.nix
@@ -2,16 +2,16 @@
 
 buildGoModule rec {
   pname = "eks-node-viewer";
-  version = "0.4.3";
+  version = "0.5.0";
 
   src = fetchFromGitHub {
     owner = "awslabs";
     repo = pname;
     rev = "v${version}";
-    sha256 = "sha256-570wOLUtKKzDDLLDrAOPAnAUpZeAqrwKsQWoHCBjKKk=";
+    sha256 = "sha256-kfX9BzARDWUOBIu67j60K38uwkRELxd/gXtEHOHAXS8=";
   };
 
-  vendorHash = "sha256-kRRUaA/psQDmcM1ZhzdZE3eyw8DWZpesJVA2zVfORGk=";
+  vendorHash = "sha256-7axI7R8cTntc1IcOwVPmPj8MHeIvhbnkYKQdqu5fZOU=";
 
   ldflags = [
     "-s"
diff --git a/nixpkgs/pkgs/applications/networking/cluster/flink/default.nix b/nixpkgs/pkgs/applications/networking/cluster/flink/default.nix
index f0547dcf5609..70c70d9ead43 100644
--- a/nixpkgs/pkgs/applications/networking/cluster/flink/default.nix
+++ b/nixpkgs/pkgs/applications/networking/cluster/flink/default.nix
@@ -22,7 +22,7 @@ stdenv.mkDerivation rec {
       --prefix PATH : ${jre}/bin
 
     cat <<EOF >> $out/opt/flink/conf/flink-conf.yaml
-    env.java.home: ${jre}"
+    env.java.home: ${jre}
     env.log.dir: /tmp/flink-logs
     EOF
   '';
diff --git a/nixpkgs/pkgs/applications/networking/cluster/terraform-providers/providers.json b/nixpkgs/pkgs/applications/networking/cluster/terraform-providers/providers.json
index 32f29dea87ca..efd18b33da1e 100644
--- a/nixpkgs/pkgs/applications/networking/cluster/terraform-providers/providers.json
+++ b/nixpkgs/pkgs/applications/networking/cluster/terraform-providers/providers.json
@@ -953,11 +953,11 @@
     "vendorHash": null
   },
   "project": {
-    "hash": "sha256-D+UBv6JEbJKGfwTJU7/W5N6otOLW2lq6+euUKpoJ+To=",
+    "hash": "sha256-UO9GBBoOzA1stMq8naXWtxomme6CVdlngVCLQlbZDv0=",
     "homepage": "https://registry.terraform.io/providers/jfrog/project",
     "owner": "jfrog",
     "repo": "terraform-provider-project",
-    "rev": "v1.3.2",
+    "rev": "v1.3.3",
     "spdx": "Apache-2.0",
     "vendorHash": "sha256-Tj+NefCIacwpPS9rNPPxV2lLeKsXJMZhf9Xo+Rzz6gI="
   },
@@ -1279,11 +1279,11 @@
     "vendorHash": "sha256-4ulRYzb4bzk0TztT04CwqlnMGw8tp7YnoCm2/NqGN7Y="
   },
   "vultr": {
-    "hash": "sha256-65QWogqHR5RYUXBYjM50PNQSuVWYGtqtULTGNy1ivag=",
+    "hash": "sha256-8pj+udTNTjT/tXggOaIOThRQkYoI3v68rEssSUojM2A=",
     "homepage": "https://registry.terraform.io/providers/vultr/vultr",
     "owner": "vultr",
     "repo": "terraform-provider-vultr",
-    "rev": "v2.16.3",
+    "rev": "v2.16.4",
     "spdx": "MPL-2.0",
     "vendorHash": null
   },
diff --git a/nixpkgs/pkgs/applications/networking/cluster/terragrunt/default.nix b/nixpkgs/pkgs/applications/networking/cluster/terragrunt/default.nix
index 1e6c86915acd..65cddcbc34d4 100644
--- a/nixpkgs/pkgs/applications/networking/cluster/terragrunt/default.nix
+++ b/nixpkgs/pkgs/applications/networking/cluster/terragrunt/default.nix
@@ -5,16 +5,16 @@
 
 buildGoModule rec {
   pname = "terragrunt";
-  version = "0.52.1";
+  version = "0.52.3";
 
   src = fetchFromGitHub {
     owner = "gruntwork-io";
     repo = pname;
     rev = "refs/tags/v${version}";
-    hash = "sha256-t1GAcOZAYdfrI0lsyKUEBbnJaGzuFP0+Mz3Yrv4Bmik=";
+    hash = "sha256-o/4L7TBdFFHuPOKAO/wP0IBixQtZHGr1GSNlsEpq710=";
   };
 
-  vendorHash = "sha256-NSrZVLQ3Qbnp94qCV7NbrEav/7LCRbTov+B2vzbuvdM=";
+  vendorHash = "sha256-RmzSKt5qt9Qb4GDrfs4dJEhGQW/jFbXPn+AOLzEyo6c=";
 
   doCheck = false;
 
diff --git a/nixpkgs/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix b/nixpkgs/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix
index 7ae6a8a11abe..d6118db16f3c 100644
--- a/nixpkgs/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix
+++ b/nixpkgs/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix
@@ -1,12 +1,12 @@
 { callPackage }: builtins.mapAttrs (pname: attrs: callPackage ./generic.nix (attrs // { inherit pname; })) {
   signal-desktop = {
     dir = "Signal";
-    version = "6.32.0";
-    hash = "sha256-FZ2wG3nkgIndeoUfXag/9jftXGDSY/MNpT8mqSZpJzA=";
+    version = "6.34.1";
+    hash = "sha256-1kffRXPQmtxIsLZVOgPXDnxUmY59q+1umy25cditRhw=";
   };
   signal-desktop-beta = {
     dir = "Signal Beta";
-    version = "6.33.0-beta.1";
-    hash = "sha256-FLCZvRYUysiE8BLMJVnn0hOkA3km0z383AjN6JvOyWI=";
+    version = "6.35.0-beta.2";
+    hash = "sha256-TgzqKGt3ojkjq+mIu0EtqXfnnZ/xulWjiuS5/0dlwIM=";
   };
 }
diff --git a/nixpkgs/pkgs/applications/networking/instant-messengers/teams-for-linux/default.nix b/nixpkgs/pkgs/applications/networking/instant-messengers/teams-for-linux/default.nix
index 157df8ca9a65..2307c4db01e3 100644
--- a/nixpkgs/pkgs/applications/networking/instant-messengers/teams-for-linux/default.nix
+++ b/nixpkgs/pkgs/applications/networking/instant-messengers/teams-for-linux/default.nix
@@ -19,18 +19,18 @@
 
 stdenv.mkDerivation (finalAttrs: {
   pname = "teams-for-linux";
-  version = "1.3.13";
+  version = "1.3.14";
 
   src = fetchFromGitHub {
     owner = "IsmaelMartinez";
     repo = "teams-for-linux";
     rev = "v${finalAttrs.version}";
-    hash = "sha256-WF2jWP6utopAMZPP/ZWOhqVGZJmACwHyLLE+HQaHJjg=";
+    hash = "sha256-2H7j8e2wPMd4cHXDKxSmyC2Ng/B3jb3/tGVTpUOU3XM=";
   };
 
   offlineCache = fetchYarnDeps {
     yarnLock = "${finalAttrs.src}/yarn.lock";
-    hash = "sha256-vgjPGO5qa4IYfW1svClJ+wP/KtIFFd3P02T2sht69C8=";
+    hash = "sha256-zB6H14VAf13pAHQmsWC51d/qqyfRmAEbltyLD5ucG4Y=";
   };
 
   nativeBuildInputs = [ yarn fixup_yarn_lock nodejs copyDesktopItems makeWrapper ];
diff --git a/nixpkgs/pkgs/applications/networking/p2p/tremotesf/default.nix b/nixpkgs/pkgs/applications/networking/p2p/tremotesf/default.nix
index 6880d8472167..4cd7358d2b77 100644
--- a/nixpkgs/pkgs/applications/networking/p2p/tremotesf/default.nix
+++ b/nixpkgs/pkgs/applications/networking/p2p/tremotesf/default.nix
@@ -15,13 +15,13 @@
 
 stdenv.mkDerivation (finalAttrs: {
   pname = "tremotesf";
-  version = "2.4.0";
+  version = "2.5.0";
 
   src = fetchFromGitHub {
     owner = "equeim";
     repo = "tremotesf2";
     rev = finalAttrs.version;
-    hash = "sha256-TKtBgMpCWIUl1bohAKCbTcZX2uaPmzeWut/OeNs/rME=";
+    hash = "sha256-mxk2BRUuet3XSNaKt2Dnnxe5dliazd1ArRSnKyoAp1s=";
     # We need this for src/libtremotesf
     fetchSubmodules = true;
   };
diff --git a/nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix b/nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix
index e5c9c2864225..356e90555f8d 100644
--- a/nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix
+++ b/nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix
@@ -1,26 +1,62 @@
-{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }:
+{ lib
+, stdenv
+, fetchFromGitHub
+, cmake
+, perl
+, python3
+, tbb
+, zlib
+, runCommand
+, bowtie2
+}:
 
-stdenv.mkDerivation rec {
+stdenv.mkDerivation (finalAttrs: {
   pname = "bowtie2";
   version = "2.5.2";
 
   src = fetchFromGitHub {
     owner = "BenLangmead";
-    repo = pname;
-    rev = "v${version}";
-    sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0=";
+    repo = "bowtie2";
+    rev = "refs/tags/v${finalAttrs.version}";
+    fetchSubmodules = true;
+    hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0=";
   };
 
+  # because of this flag, gcc on aarch64 cannot find the Threads
+  # Could NOT find Threads (missing: Threads_FOUND)
+  # TODO: check with other distros and report upstream
+  postPatch = ''
+    substituteInPlace CMakeLists.txt \
+      --replace "-m64" ""
+  '';
+
   nativeBuildInputs = [ cmake ];
 
   buildInputs = [ tbb zlib python3 perl ];
 
+  cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];
+
+  # ctest fails because of missing dependencies between tests
+  doCheck = false;
+
+  passthru.tests = {
+    ctest = runCommand "${finalAttrs.pname}-test" { } ''
+      mkdir $out
+      ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
+      ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
+      ${bowtie2}/bin/bowtie2-inspect-s $out/small
+      ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
+      ${bowtie2}/bin/bowtie2-inspect-l $out/large
+    '';
+  };
+
   meta = with lib; {
     description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
-    license = licenses.gpl3;
+    license = licenses.gpl3Plus;
     homepage = "http://bowtie-bio.sf.net/bowtie2";
+    changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}";
     maintainers = with maintainers; [ rybern ];
     platforms = platforms.all;
-    broken = stdenv.isAarch64; # only x86 is supported
+    mainProgram = "bowtie2";
   };
-}
+})
diff --git a/nixpkgs/pkgs/applications/science/biology/poretools/default.nix b/nixpkgs/pkgs/applications/science/biology/poretools/default.nix
index efbedf9a121a..efbedf9a121a 100755..100644
--- a/nixpkgs/pkgs/applications/science/biology/poretools/default.nix
+++ b/nixpkgs/pkgs/applications/science/biology/poretools/default.nix
diff --git a/nixpkgs/pkgs/applications/science/biology/trimal/default.nix b/nixpkgs/pkgs/applications/science/biology/trimal/default.nix
index b27a63a2135a..b27a63a2135a 100755..100644
--- a/nixpkgs/pkgs/applications/science/biology/trimal/default.nix
+++ b/nixpkgs/pkgs/applications/science/biology/trimal/default.nix
diff --git a/nixpkgs/pkgs/applications/science/biology/vcftools/default.nix b/nixpkgs/pkgs/applications/science/biology/vcftools/default.nix
index a4ec84d4d506..a4ec84d4d506 100755..100644
--- a/nixpkgs/pkgs/applications/science/biology/vcftools/default.nix
+++ b/nixpkgs/pkgs/applications/science/biology/vcftools/default.nix
diff --git a/nixpkgs/pkgs/applications/science/misc/root/default.nix b/nixpkgs/pkgs/applications/science/misc/root/default.nix
index 993bc26bba28..a03709c1437d 100644
--- a/nixpkgs/pkgs/applications/science/misc/root/default.nix
+++ b/nixpkgs/pkgs/applications/science/misc/root/default.nix
@@ -58,7 +58,7 @@
 
 stdenv.mkDerivation rec {
   pname = "root";
-  version = "6.28.06";
+  version = "6.28.08";
 
   passthru = {
     tests = import ./tests { inherit callPackage; };
@@ -66,7 +66,7 @@ stdenv.mkDerivation rec {
 
   src = fetchurl {
     url = "https://root.cern.ch/download/root_v${version}.source.tar.gz";
-    hash = "sha256-rztnO5rKOTpcmuG/huqyZyqvGEG2WMXG56MKuTxYZTM=";
+    hash = "sha256-o+ZLTAH4fNm75X5h75a0FibkmwRGCVBw1B2b+6NSaGI=";
   };
 
   nativeBuildInputs = [ makeWrapper cmake pkg-config git ];
diff --git a/nixpkgs/pkgs/applications/video/kodi/addons/inputstream-adaptive/default.nix b/nixpkgs/pkgs/applications/video/kodi/addons/inputstream-adaptive/default.nix
index 1e8e2ae2f4d4..61e5147be360 100644
--- a/nixpkgs/pkgs/applications/video/kodi/addons/inputstream-adaptive/default.nix
+++ b/nixpkgs/pkgs/applications/video/kodi/addons/inputstream-adaptive/default.nix
@@ -10,13 +10,13 @@ in
 buildKodiBinaryAddon rec {
   pname = "inputstream-adaptive";
   namespace = "inputstream.adaptive";
-  version = "20.3.9";
+  version = "20.3.13";
 
   src = fetchFromGitHub {
     owner = "xbmc";
     repo = "inputstream.adaptive";
     rev = "${version}-${rel}";
-    sha256 = "sha256-Z5p/lw7qg6aacJ0eSqswaiwTOsUmuDbNlRRs51LdjRw=";
+    sha256 = "sha256-xvU+DcVEaQ/1sm6o21/6N1znCtzrct0qDhMxXGFZjL4=";
   };
 
   extraCMakeFlags = [
diff --git a/nixpkgs/pkgs/applications/video/kodi/addons/netflix/default.nix b/nixpkgs/pkgs/applications/video/kodi/addons/netflix/default.nix
index ab034c13755e..3352ae4c63d3 100644
--- a/nixpkgs/pkgs/applications/video/kodi/addons/netflix/default.nix
+++ b/nixpkgs/pkgs/applications/video/kodi/addons/netflix/default.nix
@@ -3,13 +3,13 @@
 buildKodiAddon rec {
   pname = "netflix";
   namespace = "plugin.video.netflix";
-  version = "1.20.2";
+  version = "1.22.3";
 
   src = fetchFromGitHub {
     owner = "CastagnaIT";
     repo = namespace;
     rev = "v${version}";
-    sha256 = "sha256-k2O8a0P+TzQVoFQJkzmdqmkKh3Aj7OlsnuhJfUwxOmI=";
+    sha256 = "sha256-8NGj8n1p8euqYYdPDSeFh2ZE9lly5ThSmg69yXY3Te8=";
   };
 
   propagatedBuildInputs = [
@@ -24,6 +24,6 @@ buildKodiAddon rec {
     homepage = "https://github.com/CastagnaIT/plugin.video.netflix";
     description = "Netflix VOD Services Add-on";
     license = licenses.mit;
-    maintainers = teams.kodi.members;
+    maintainers = teams.kodi.members ++ [ maintainers.pks ];
   };
 }
diff --git a/nixpkgs/pkgs/applications/video/kodi/addons/youtube/default.nix b/nixpkgs/pkgs/applications/video/kodi/addons/youtube/default.nix
index bdc4be3a23fa..3d3683ed8776 100644
--- a/nixpkgs/pkgs/applications/video/kodi/addons/youtube/default.nix
+++ b/nixpkgs/pkgs/applications/video/kodi/addons/youtube/default.nix
@@ -1,13 +1,15 @@
-{ lib, buildKodiAddon, fetchzip, addonUpdateScript, six, requests, infotagger, inputstreamhelper }:
+{ lib, buildKodiAddon, fetchFromGitHub, six, requests, infotagger, inputstreamhelper }:
 
 buildKodiAddon rec {
   pname = "youtube";
   namespace = "plugin.video.youtube";
-  version = "7.0.1";
+  version = "7.0.2.2";
 
-  src = fetchzip {
-    url = "https://mirrors.kodi.tv/addons/nexus/${namespace}/${namespace}-${version}.zip";
-    sha256 = "sha256-Wdju7d2kFX0V1J1TB75qEVq0UWN2xYYFNlD8UTt1New=";
+  src = fetchFromGitHub {
+    owner = "anxdpanic";
+    repo = "plugin.video.youtube";
+    rev = "v${version}";
+    hash = "sha256-BUeE/8oQYBiq4XgIp4nv0hjEQz3nnkDWCnAf4kpptwk=";
   };
 
   propagatedBuildInputs = [
@@ -19,9 +21,6 @@ buildKodiAddon rec {
 
   passthru = {
     pythonPath = "resources/lib";
-    updateScript = addonUpdateScript {
-      attrPath = "kodi.packages.youtube";
-    };
   };
 
   meta = with lib; {
diff --git a/nixpkgs/pkgs/applications/virtualization/vmware-workstation/default.nix b/nixpkgs/pkgs/applications/virtualization/vmware-workstation/default.nix
index 8fe79b6e237c..8fe79b6e237c 100755..100644
--- a/nixpkgs/pkgs/applications/virtualization/vmware-workstation/default.nix
+++ b/nixpkgs/pkgs/applications/virtualization/vmware-workstation/default.nix
diff --git a/nixpkgs/pkgs/build-support/fetchdocker/credentials.nix b/nixpkgs/pkgs/build-support/fetchdocker/credentials.nix
index da1984832684..f8a229ccb6bb 100644
--- a/nixpkgs/pkgs/build-support/fetchdocker/credentials.nix
+++ b/nixpkgs/pkgs/build-support/fetchdocker/credentials.nix
@@ -1,3 +1,4 @@
+{ lib }:
 # We provide three paths to get the credentials into the builder's
 # environment:
 #
diff --git a/nixpkgs/pkgs/build-support/fetchdocker/generic-fetcher.nix b/nixpkgs/pkgs/build-support/fetchdocker/generic-fetcher.nix
index 6a7b977db29f..95b193490a82 100644
--- a/nixpkgs/pkgs/build-support/fetchdocker/generic-fetcher.nix
+++ b/nixpkgs/pkgs/build-support/fetchdocker/generic-fetcher.nix
@@ -1,7 +1,7 @@
 { stdenv, lib, haskellPackages, writeText, gawk }:
 let
   awk                   = "${gawk}/bin/awk";
-  dockerCredentialsFile = import ./credentials.nix;
+  dockerCredentialsFile = import ./credentials.nix { inherit lib; };
 in
 { fetcher
 , name
diff --git a/nixpkgs/pkgs/build-support/kernel/make-initrd-ng/src/main.rs b/nixpkgs/pkgs/build-support/kernel/make-initrd-ng/src/main.rs
index 53096a842329..daa688976c6c 100644
--- a/nixpkgs/pkgs/build-support/kernel/make-initrd-ng/src/main.rs
+++ b/nixpkgs/pkgs/build-support/kernel/make-initrd-ng/src/main.rs
@@ -195,7 +195,7 @@ fn handle_path(
                         .wrap_err_with(|| format!("failed to resolve symlink of {:?}", source))?;
 
                     // Create the link, then push its target to the queue
-                    if !target.exists() {
+                    if !target.exists() && !target.is_symlink() {
                         unix::fs::symlink(&link_target, &target).wrap_err_with(|| {
                             format!("failed to symlink {:?} to {:?}", link_target, target)
                         })?;
diff --git a/nixpkgs/pkgs/by-name/al/alpine-make-rootfs/package.nix b/nixpkgs/pkgs/by-name/al/alpine-make-rootfs/package.nix
new file mode 100644
index 000000000000..1fcfc23710a5
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/al/alpine-make-rootfs/package.nix
@@ -0,0 +1,33 @@
+{ stdenvNoCC, lib, fetchFromGitHub, makeWrapper, apk-tools, coreutils, findutils, gnugrep, gnused, gnutar, gzip, rsync, util-linux, wget
+}:
+stdenvNoCC.mkDerivation rec {
+  pname = "alpine-make-rootfs";
+  version = "0.7.0";
+
+  src = fetchFromGitHub {
+    owner = "alpinelinux";
+    repo = "alpine-make-rootfs";
+    rev = "v${version}";
+    hash = "sha256-B5qYQ6ah4hFZfb3S5vwgevh7aEHI3YGLoA+IyipaDck=";
+  };
+
+  nativeBuildInputs = [ makeWrapper ];
+
+  dontBuild = true;
+  makeFlags = [ "PREFIX=$(out)" ];
+
+  postInstall = ''
+    wrapProgram $out/bin/alpine-make-rootfs --set PATH ${lib.makeBinPath [
+      apk-tools coreutils findutils gnugrep gnused gnutar gzip rsync util-linux wget
+    ]}
+  '';
+
+  meta = with lib; {
+    homepage = "https://github.com/alpinelinux/alpine-make-rootfs";
+    description = "Make customized Alpine Linux rootfs (base image) for containers";
+    mainProgram = "alpine-make-rootfs";
+    maintainers = with maintainers; [ danielsidhion ];
+    license = licenses.mit;
+    platforms = platforms.linux;
+  };
+}
diff --git a/nixpkgs/pkgs/development/libraries/argagg/default.nix b/nixpkgs/pkgs/by-name/ar/argagg/package.nix
index 7ff9eaac1e3e..bb8507abbe97 100644
--- a/nixpkgs/pkgs/development/libraries/argagg/default.nix
+++ b/nixpkgs/pkgs/by-name/ar/argagg/package.nix
@@ -4,27 +4,22 @@
 , cmake
 }:
 
-stdenv.mkDerivation rec {
+stdenv.mkDerivation (finalAttrs: {
   pname = "argagg";
-  version = "0.4.6";
+  version = "0.4.7";
 
   src = fetchFromGitHub {
     owner = "vietjtnguyen";
-    repo = pname;
-    rev = version;
-    hash = "sha256-MCtlAPfwdJpgfS8IH+zlcgaaxZ5AsP4hJvbZAFtOa4o=";
+    repo = "argagg";
+    rev = finalAttrs.version;
+    hash = "sha256-G0PzoKpUyb1MaziLvHgasq98jPODUu4EgPzywRjuIN8=";
   };
 
-  patches = [
-    # Fix compilation of macro catch statement
-    ./0001-catch.diff
-  ];
-
   nativeBuildInputs = [
     cmake
   ];
 
-  meta = with lib; {
+  meta = {
     homepage = "https://github.com/vietjtnguyen/argagg";
     description = "Argument Aggregator";
     longDescription = ''
@@ -38,9 +33,9 @@ stdenv.mkDerivation rec {
       types until you access them, so the result structures end up just being
       pointers into the original command line argument C-strings.
     '';
-    license = licenses.mit;
-    maintainers = with maintainers; [ AndersonTorres ];
-    platforms = with platforms; all;
+    license = lib.licenses.mit;
+    maintainers = with lib.maintainers; [ AndersonTorres ];
+    platforms = lib.platforms.all;
     badPlatforms = [ "aarch64-darwin" ];
   };
-}
+})
diff --git a/nixpkgs/pkgs/development/libraries/argtable/default.nix b/nixpkgs/pkgs/by-name/ar/argtable/package.nix
index 9752b9600397..18206202691c 100644
--- a/nixpkgs/pkgs/development/libraries/argtable/default.nix
+++ b/nixpkgs/pkgs/by-name/ar/argtable/package.nix
@@ -4,29 +4,29 @@
 , cmake
 }:
 
-stdenv.mkDerivation rec {
+stdenv.mkDerivation (finalAttrs: {
   pname = "argtable";
-  version = "3.2.1";
-  srcVersion = "v${version}.52f24e5";
+  version = "3.2.2";
+  srcVersion = "v${finalAttrs.version}.f25c624";
 
   src = fetchFromGitHub {
     owner = "argtable";
     repo = "argtable3";
-    rev = srcVersion;
-    hash = "sha256-HFsk91uJXQ0wpvAQxP4/yZwRQx9kLH7KgB3Y/+zcZC0=";
+    rev = finalAttrs.srcVersion;
+    hash = "sha256-X89xFLDs6NEgjzzwy8kplvTgukQd/CV3Xa9A3JXecf4=";
   };
 
   nativeBuildInputs = [ cmake ];
 
   cmakeFlags = [
-    "-DBUILD_SHARED_LIBS=ON"
+    (lib.cmakeBool "BUILD_SHARED_LIBS" true)
   ];
 
   postPatch = ''
     patchShebangs tools/build
   '';
 
-  meta = with lib; {
+  meta = {
     homepage = "https://github.com/argtable/argtable3";
     description = "A single-file, ANSI C command-line parsing library";
     longDescription = ''
@@ -37,11 +37,11 @@ stdenv.mkDerivation rec {
       handling logic and textual descriptions of the command line syntax, which
       are essential but tedious to implement for a robust CLI program.
     '';
-    license = with licenses; bsd3;
-    maintainers = with maintainers; [ AndersonTorres artuuge ];
-    platforms = with platforms; all;
+    license = lib.licenses.bsd3;
+    maintainers = with lib.maintainers; [ AndersonTorres artuuge ];
+    platforms = lib.platforms.all;
   };
-}
+})
 # TODO: a NixOS test suite
 # TODO: multiple outputs
 # TODO: documentation
diff --git a/nixpkgs/pkgs/by-name/ba/bashly/Gemfile b/nixpkgs/pkgs/by-name/ba/bashly/Gemfile
new file mode 100644
index 000000000000..b5d29f5f4c59
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/ba/bashly/Gemfile
@@ -0,0 +1,2 @@
+source 'https://rubygems.org'
+gem 'bashly'
diff --git a/nixpkgs/pkgs/by-name/ba/bashly/Gemfile.lock b/nixpkgs/pkgs/by-name/ba/bashly/Gemfile.lock
new file mode 100644
index 000000000000..0021014b3728
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/ba/bashly/Gemfile.lock
@@ -0,0 +1,59 @@
+GEM
+  remote: https://rubygems.org/
+  specs:
+    bashly (1.1.1)
+      colsole (>= 0.8.1, < 2)
+      completely (~> 0.6.1)
+      filewatcher (~> 2.0)
+      gtx (~> 0.1)
+      lp (~> 0.2)
+      mister_bin (~> 0.7)
+      psych (>= 3.3.2, < 7)
+      tty-markdown (~> 0.7)
+    colsole (1.0.0)
+    completely (0.6.1)
+      colsole (>= 0.8.1, < 2)
+      mister_bin (~> 0.7)
+    docopt_ng (0.7.1)
+    filewatcher (2.1.0)
+      module_methods (~> 0.1.0)
+    gtx (0.1.0)
+    kramdown (2.4.0)
+      rexml
+    lp (0.2.1)
+    mister_bin (0.7.6)
+      colsole (>= 0.8.1, < 2)
+      docopt_ng (~> 0.7, >= 0.7.1)
+    module_methods (0.1.0)
+    pastel (0.8.0)
+      tty-color (~> 0.5)
+    psych (5.1.1.1)
+      stringio
+    rexml (3.2.6)
+    rouge (4.1.3)
+    stringio (3.0.8)
+    strings (0.2.1)
+      strings-ansi (~> 0.2)
+      unicode-display_width (>= 1.5, < 3.0)
+      unicode_utils (~> 1.4)
+    strings-ansi (0.2.0)
+    tty-color (0.6.0)
+    tty-markdown (0.7.2)
+      kramdown (>= 1.16.2, < 3.0)
+      pastel (~> 0.8)
+      rouge (>= 3.14, < 5.0)
+      strings (~> 0.2.0)
+      tty-color (~> 0.5)
+      tty-screen (~> 0.8)
+    tty-screen (0.8.1)
+    unicode-display_width (2.5.0)
+    unicode_utils (1.4.0)
+
+PLATFORMS
+  x86_64-linux
+
+DEPENDENCIES
+  bashly
+
+BUNDLED WITH
+   2.3.26
diff --git a/nixpkgs/pkgs/by-name/ba/bashly/gemset.nix b/nixpkgs/pkgs/by-name/ba/bashly/gemset.nix
new file mode 100644
index 000000000000..e24c0b3483d7
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/ba/bashly/gemset.nix
@@ -0,0 +1,231 @@
+{
+  bashly = {
+    dependencies = ["colsole" "completely" "filewatcher" "gtx" "lp" "mister_bin" "psych" "tty-markdown"];
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "1rhzbpv8j5qcm5a84m4vzrryb0j8z90q6djbpid4ay2fr492kvkq";
+      type = "gem";
+    };
+    version = "1.1.1";
+  };
+  colsole = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "1fvf6dz2wsvjk7q24z0dm8lajq3p2l6i5ywf3mxj683rmhwq49bg";
+      type = "gem";
+    };
+    version = "1.0.0";
+  };
+  completely = {
+    dependencies = ["colsole" "mister_bin"];
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "01nk1cigb09z6rjy41qrhqf58cgpqm43xwjdkz33mfmwrnz04cw1";
+      type = "gem";
+    };
+    version = "0.6.1";
+  };
+  docopt_ng = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "0rsnl5s7k2s1gl4n4dg68ssg577kf11sl4a4l2lb2fpswj718950";
+      type = "gem";
+    };
+    version = "0.7.1";
+  };
+  filewatcher = {
+    dependencies = ["module_methods"];
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "03f9v57c5zag09mi10yjhdx7y0vv2w5wrnwzbij9hhkwh43rk077";
+      type = "gem";
+    };
+    version = "2.1.0";
+  };
+  gtx = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "10hfhicvv371gy1i16x6vry1xglvxl0zh7qr6f14pqsx32qih6ff";
+      type = "gem";
+    };
+    version = "0.1.0";
+  };
+  kramdown = {
+    dependencies = ["rexml"];
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "1ic14hdcqxn821dvzki99zhmcy130yhv5fqfffkcf87asv5mnbmn";
+      type = "gem";
+    };
+    version = "2.4.0";
+  };
+  lp = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "0ns1aza32n929w7smg1dsn4g6qlfi7k1jrvssyn35cicmwn0gyyr";
+      type = "gem";
+    };
+    version = "0.2.1";
+  };
+  mister_bin = {
+    dependencies = ["colsole" "docopt_ng"];
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "0xx8cxvzcn47zsnshcllf477x4rbssrchvp76929qnsg5k9q7fas";
+      type = "gem";
+    };
+    version = "0.7.6";
+  };
+  module_methods = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "1886wjscfripgzlmyvcd0jmlzwr6hxvklm2a5rm32dw5bf7bvjki";
+      type = "gem";
+    };
+    version = "0.1.0";
+  };
+  pastel = {
+    dependencies = ["tty-color"];
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "0xash2gj08dfjvq4hy6l1z22s5v30fhizwgs10d6nviggpxsj7a8";
+      type = "gem";
+    };
+    version = "0.8.0";
+  };
+  psych = {
+    dependencies = ["stringio"];
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "0wjzrkssjfjpynij5dpycyflhqbjvi1gc2j73xgq3b196s1d3c24";
+      type = "gem";
+    };
+    version = "5.1.1.1";
+  };
+  rexml = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "05i8518ay14kjbma550mv0jm8a6di8yp5phzrd8rj44z9qnrlrp0";
+      type = "gem";
+    };
+    version = "3.2.6";
+  };
+  rouge = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "19drl3x8fw65v3mpy7fk3cf3dfrywz5alv98n2rm4pp04vdn71lw";
+      type = "gem";
+    };
+    version = "4.1.3";
+  };
+  stringio = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "0ix96dxbjqlpymdigb4diwrifr0bq7qhsrng95fkkp18av326nqk";
+      type = "gem";
+    };
+    version = "3.0.8";
+  };
+  strings = {
+    dependencies = ["strings-ansi" "unicode-display_width" "unicode_utils"];
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "1yynb0qhhhplmpzavfrrlwdnd1rh7rkwzcs4xf0mpy2wr6rr6clk";
+      type = "gem";
+    };
+    version = "0.2.1";
+  };
+  strings-ansi = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "120wa6yjc63b84lprglc52f40hx3fx920n4dmv14rad41rv2s9lh";
+      type = "gem";
+    };
+    version = "0.2.0";
+  };
+  tty-color = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "0aik4kmhwwrmkysha7qibi2nyzb4c8kp42bd5vxnf8sf7b53g73g";
+      type = "gem";
+    };
+    version = "0.6.0";
+  };
+  tty-markdown = {
+    dependencies = ["kramdown" "pastel" "rouge" "strings" "tty-color" "tty-screen"];
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "04f599zn5rfndq4d9l0acllfpc041bzdkkz2h6x0dl18f2wivn0y";
+      type = "gem";
+    };
+    version = "0.7.2";
+  };
+  tty-screen = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "18jr6s1cg8yb26wzkqa6874q0z93rq0y5aw092kdqazk71y6a235";
+      type = "gem";
+    };
+    version = "0.8.1";
+  };
+  unicode-display_width = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "1d0azx233nags5jx3fqyr23qa2rhgzbhv8pxp46dgbg1mpf82xky";
+      type = "gem";
+    };
+    version = "2.5.0";
+  };
+  unicode_utils = {
+    groups = ["default"];
+    platforms = [];
+    source = {
+      remotes = ["https://rubygems.org"];
+      sha256 = "0h1a5yvrxzlf0lxxa1ya31jcizslf774arnsd89vgdhk4g7x08mr";
+      type = "gem";
+    };
+    version = "1.4.0";
+  };
+}
diff --git a/nixpkgs/pkgs/by-name/ba/bashly/package.nix b/nixpkgs/pkgs/by-name/ba/bashly/package.nix
new file mode 100644
index 000000000000..5a3d6661caa2
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/ba/bashly/package.nix
@@ -0,0 +1,38 @@
+{ lib
+, stdenvNoCC
+, bundlerApp
+}:
+
+let
+  bashlyBundlerApp = bundlerApp {
+    pname = "bashly";
+    gemdir = ./.;
+    exes = [ "bashly" ];
+  };
+in
+stdenvNoCC.mkDerivation (finalAttrs: {
+  name = "bashly";
+
+  dontUnpack = true;
+
+  installPhase = ''
+    runHook preInstall
+
+    mkdir $out;
+    cd $out;
+
+    mkdir bin; pushd bin;
+    ln -vs ${bashlyBundlerApp}/bin/bashly;
+
+    runHook postInstall
+  '';
+
+  meta = {
+    description = "Bash command line framework and CLI generator";
+    homepage = "https://github.com/DannyBen/bashly";
+    license = lib.licenses.mit;
+    mainProgram = "bashly";
+    maintainers = with lib.maintainers; [ drupol ];
+    platforms = lib.platforms.unix;
+  };
+})
diff --git a/nixpkgs/pkgs/by-name/fi/firewalk/package.nix b/nixpkgs/pkgs/by-name/fi/firewalk/package.nix
new file mode 100644
index 000000000000..8909a61062c7
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/fi/firewalk/package.nix
@@ -0,0 +1,27 @@
+{ lib
+, stdenv
+, fetchurl
+, libnet
+, libpcap
+, libdnet
+}:
+
+stdenv.mkDerivation (finalAttrs: {
+  pname = "firewalk";
+  version = "5.0";
+
+  src = fetchurl {
+    url = "https://salsa.debian.org/pkg-security-team/firewalk/-/archive/upstream/${finalAttrs.version}/firewalk-upstream-${finalAttrs.version}.tar.gz";
+    hash = "sha256-f0sHzcH3faeg7epfpWXbgaHrRWaWBKMEqLdy38+svGo=";
+  };
+
+  buildInputs = [ libnet libpcap libdnet ];
+
+  meta = with lib; {
+    description = "Gateway ACL scanner";
+    homepage = "http://packetfactory.openwall.net/projects/firewalk/";
+    license = licenses.bsd2;
+    maintainers = with maintainers; [ tochiaha ];
+    platforms = platforms.linux;
+  };
+})
diff --git a/nixpkgs/pkgs/by-name/fl/flip/package.nix b/nixpkgs/pkgs/by-name/fl/flip/package.nix
new file mode 100644
index 000000000000..f7957c0990b0
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/fl/flip/package.nix
@@ -0,0 +1,32 @@
+{
+  stdenv,
+  lib,
+  fetchFromGitHub,
+  cmake
+}:
+
+stdenv.mkDerivation {
+  pname = "flip";
+  version = "1.2";
+
+  src = fetchFromGitHub {
+    owner = "NVlabs";
+    repo = "flip";
+    rev = "8303adb2060d69423d040453995f4ad1a030a1cc";
+    hash = "sha256-jSB79qOtnW/cjApIDcLRqGabnzCIwS7saA+aF1TcyV0=";
+  };
+
+  nativeBuildInputs = [
+    cmake
+  ];
+
+  enableParallelBuilding = true;
+
+  meta = with lib; {
+    description = "A tool for visualizing and communicating the errors in rendered images.";
+    license = licenses.bsd3;
+    platforms = platforms.unix;
+    maintainers = with maintainers; [ zmitchell ];
+    mainProgram = "flip";
+  };
+}
diff --git a/nixpkgs/pkgs/by-name/hi/hifile/package.nix b/nixpkgs/pkgs/by-name/hi/hifile/package.nix
new file mode 100644
index 000000000000..bf2bda5100dc
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/hi/hifile/package.nix
@@ -0,0 +1,41 @@
+{ lib, appimageTools, fetchurl }:
+
+let
+  version = "0.9.9.5";
+  pname = "hifile";
+
+  src = fetchurl {
+    url = "https://www.hifile.app/files/HiFile-${version}.AppImage";
+    hash = "sha256-Ks/NLPm5loo9q8pT0LdtfcrC38203beNE74sbEpyuJM=";
+  };
+
+  appimageContents = appimageTools.extractType2 {
+    inherit pname version src;
+  };
+
+in
+appimageTools.wrapType2 rec {
+  inherit pname version src;
+
+  extraInstallCommands = ''
+    mv $out/bin/${pname}-${version} $out/bin/${pname}
+
+    install -m 444 -D ${appimageContents}/HiFile.desktop $out/share/applications/HiFile.desktop
+    install -m 444 -D ${appimageContents}/HiFile.png $out/share/icons/hicolor/512x512/apps/HiFile.png
+    substituteInPlace $out/share/applications/HiFile.desktop \
+      --replace 'Exec=HiFile' 'Exec=${pname}'
+  '';
+
+  meta = with lib; {
+    description = "Dual-pane graphical file manager for Windows, macOS and Linux";
+    longDescription = ''
+      HiFile is the next evolution of file managers. Its mission is to increase your productivity whenever you work with files or folders. It aims to be better in every way - more convenient, more versatile, more efficient, more elegant, more customizable, and more fun.
+    '';
+    homepage = "https://www.hifile.app/";
+    downloadPage = "https://www.hifile.app/download";
+    license = licenses.unfree;
+    sourceProvenance = with sourceTypes; [ binaryNativeCode ];
+    maintainers = with maintainers; [ ymstnt ];
+    platforms = [ "x86_64-linux" ];
+  };
+}
diff --git a/nixpkgs/pkgs/by-name/ji/jitterentropy-rngd/package.nix b/nixpkgs/pkgs/by-name/ji/jitterentropy-rngd/package.nix
new file mode 100644
index 000000000000..feb7d1e2fb12
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/ji/jitterentropy-rngd/package.nix
@@ -0,0 +1,34 @@
+{ lib, stdenv, fetchFromGitHub }:
+
+stdenv.mkDerivation rec {
+  pname = "jitterentropy-rngd";
+  version = "1.2.8";
+
+  src = fetchFromGitHub {
+    owner = "smuellerDD";
+    repo = pname;
+    rev = "v${version}";
+    hash = "sha256-LDym636ss3B1G/vrqatu9g5vbVEeDX0JQcxZ/IxGeY0=";
+  };
+
+  enableParallelBuilding = true;
+
+  installPhase = ''
+    runHook preInstall
+
+    mkdir -p $out
+    make install DESTDIR= PREFIX=$out UNITDIR=$out/lib/systemd/system
+
+    runHook postInstall
+  '';
+
+  meta = with lib; {
+    description = ''A random number generator, which injects entropy to the kernel'';
+    homepage = "https://github.com/smuellerDD/jitterentropy-rngd";
+    changelog = "https://github.com/smuellerDD/jitterentropy-rngd/releases/tag/v${version}";
+    license = [ licenses.gpl2Only licenses.bsd3 ];
+    platforms = platforms.linux;
+    maintainers = with maintainers; [ thillux ];
+    mainProgram = "jitterentropy-rngd";
+  };
+}
diff --git a/nixpkgs/pkgs/by-name/on/onedriver/package.nix b/nixpkgs/pkgs/by-name/on/onedriver/package.nix
new file mode 100644
index 000000000000..f4087401ea92
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/on/onedriver/package.nix
@@ -0,0 +1,64 @@
+{ buildGoModule
+, fetchFromGitHub
+, lib
+, pkg-config
+, webkitgtk
+, glib
+, fuse
+, installShellFiles
+}:
+let
+  pname = "onedriver";
+  version = "0.13.0-2";
+
+  src = fetchFromGitHub {
+    owner = "jstaf";
+    repo = "onedriver";
+    rev = "v${version}";
+    hash = "sha256-Bcjgmx9a4pTRhkzR3tbOB6InjvuH71qomv4t+nRNc+w=";
+  };
+in
+buildGoModule {
+  inherit pname version src;
+  vendorHash = "sha256-OOiiKtKb+BiFkoSBUQQfqm4dMfDW3Is+30Kwcdg8LNA=";
+
+  nativeBuildInputs = [ pkg-config installShellFiles ];
+  buildInputs = [ webkitgtk glib fuse ];
+
+  ldflags = [ "-X github.com/jstaf/onedriver/cmd/common.commit=v${version}" ];
+
+  subPackages = [
+    "cmd/onedriver"
+    "cmd/onedriver-launcher"
+  ];
+
+  postInstall = ''
+    echo "Running postInstall"
+    install -Dm644 ./resources/onedriver.svg $out/share/icons/onedriver/onedriver.svg
+    install -Dm644 ./resources/onedriver.png $out/share/icons/onedriver/onedriver.png
+    install -Dm644 ./resources/onedriver-128.png $out/share/icons/onedriver/onedriver-128.png
+
+    install -Dm644 ./resources/onedriver.desktop $out/share/applications/onedriver.desktop
+
+    mkdir -p $out/share/man/man1
+    installManPage ./resources/onedriver.1
+
+    substituteInPlace $out/share/applications/onedriver.desktop \
+      --replace "/usr/bin/onedriver-launcher" "$out/bin/onedriver-launcher" \
+      --replace "/usr/share/icons" "$out/share/icons"
+  '';
+
+  meta = with lib; {
+    description = "A network filesystem for Linux";
+    longDescription = ''
+      onedriver is a network filesystem that gives your computer direct access to your files on Microsoft OneDrive.
+      This is not a sync client. Instead of syncing files, onedriver performs an on-demand download of files when
+      your computer attempts to use them. onedriver allows you to use files on OneDrive as if they were files on
+      your local computer.
+    '';
+    inherit (src.meta) homepage;
+    license = licenses.gpl3Plus;
+    maintainers = [ maintainers.massimogengarelli ];
+    platforms = platforms.linux;
+  };
+}
diff --git a/nixpkgs/pkgs/by-name/pr/presenterm/package.nix b/nixpkgs/pkgs/by-name/pr/presenterm/package.nix
index e3c42056a275..6e09e86f2059 100644
--- a/nixpkgs/pkgs/by-name/pr/presenterm/package.nix
+++ b/nixpkgs/pkgs/by-name/pr/presenterm/package.nix
@@ -2,16 +2,16 @@
 
 rustPlatform.buildRustPackage rec {
   pname = "presenterm";
-  version = "0.2.0";
+  version = "0.2.1";
 
   src = fetchFromGitHub {
     owner = "mfontanini";
     repo = "presenterm";
-    rev = version;
-    hash = "sha256-mNWnUUezKIffh5gMgMMdvApNZZTxxB8XrL0jFLyBxuk=";
+    rev = "v${version}";
+    hash = "sha256-sXVMVU34gxZKGNye6hoyv07a7N7f6UbivA6thbSOeZA=";
   };
 
-  cargoHash = "sha256-JLPJLhWN/yXpPIHa+FJ2aQ/GDUFKtZ7t+/8rvR8WNKM=";
+  cargoHash = "sha256-PsDaXMws/8hEvAZwClQ4okGuryg1iKg0IBr7Xp2QYBE=";
 
   meta = with lib; {
     description = "A terminal based slideshow tool";
diff --git a/nixpkgs/pkgs/applications/editors/tecoc/default.nix b/nixpkgs/pkgs/by-name/te/tecoc/package.nix
index 778115dfbfa7..a5531b3aa874 100644
--- a/nixpkgs/pkgs/applications/editors/tecoc/default.nix
+++ b/nixpkgs/pkgs/by-name/te/tecoc/package.nix
@@ -72,7 +72,7 @@ stdenv.mkDerivation (finalAttrs: {
       TECOC is a portable C implementation of TECO-11.
     '';
     license = {
-      url = "https://github.com/blakemcbride/TECOC/tree/master/doc/readme-1st.txt";
+      url = "https://github.com/blakemcbride/TECOC/blob/${finalAttrs.src.rev}/doc/readme-1st.txt";
     };
     maintainers = [ lib.maintainers.AndersonTorres ];
     platforms = lib.platforms.unix;
diff --git a/nixpkgs/pkgs/by-name/tp/tpm2-totp/package.nix b/nixpkgs/pkgs/by-name/tp/tpm2-totp/package.nix
new file mode 100644
index 000000000000..766c6e138af6
--- /dev/null
+++ b/nixpkgs/pkgs/by-name/tp/tpm2-totp/package.nix
@@ -0,0 +1,46 @@
+{ lib
+, stdenv
+, fetchFromGitHub
+, tpm2-tss
+, autoreconfHook
+, autoconf-archive
+, pkg-config
+, qrencode
+}:
+
+stdenv.mkDerivation rec {
+  pname = "tpm2-totp";
+  version = "0.3.0";
+
+  src = fetchFromGitHub {
+    owner = "tpm2-software";
+    repo = "tpm2-totp";
+    rev = "v${version}";
+    hash = "sha256-aeWhI2GQcWa0xAqlmHfcbCMg78UqcD6eanLlEVNVnRM=";
+  };
+
+  preConfigure = ''
+    echo '0.3.0' > VERSION
+  '';
+
+  nativeBuildInputs = [
+    autoreconfHook
+    autoconf-archive
+    pkg-config
+  ];
+
+  buildInputs = [
+    tpm2-tss
+    qrencode
+  ];
+
+  meta = with lib; {
+    description = "Attest the trustworthiness of a device against a human using time-based one-time passwords";
+    homepage = "https://github.com/tpm2-software/tpm2-totp";
+    changelog = "https://github.com/tpm2-software/tpm2-totp/blob/${src.rev}/CHANGELOG.md";
+    license = licenses.bsd3;
+    mainProgram = "tpm2-totp";
+    platforms = platforms.all;
+    maintainers = with maintainers; [ raitobezarius ];
+  };
+}
diff --git a/nixpkgs/pkgs/by-name/tr/trealla/package.nix b/nixpkgs/pkgs/by-name/tr/trealla/package.nix
index 1a9d5569f235..6aee9c1598b9 100644
--- a/nixpkgs/pkgs/by-name/tr/trealla/package.nix
+++ b/nixpkgs/pkgs/by-name/tr/trealla/package.nix
@@ -17,13 +17,13 @@
 assert lib.elem lineEditingLibrary [ "isocline" "readline" ];
 stdenv.mkDerivation (finalAttrs: {
   pname = "trealla";
-  version = "2.28.12";
+  version = "2.29.36";
 
   src = fetchFromGitHub {
     owner = "trealla-prolog";
     repo = "trealla";
     rev = "v${finalAttrs.version}";
-    hash = "sha256-uWCpCjYFtK2pNeHHZWhWI6YZ+cllQpkKz//nHracl5s=";
+    hash = "sha256-tQp2DOBW71Wm1aQqspW9tuH8aM8ir+ilZiENdElB/+0=";
   };
 
   postPatch = ''
diff --git a/nixpkgs/pkgs/data/fonts/vazir-fonts/default.nix b/nixpkgs/pkgs/data/fonts/vazir-fonts/default.nix
index d65b270c881f..d65b270c881f 100755..100644
--- a/nixpkgs/pkgs/data/fonts/vazir-fonts/default.nix
+++ b/nixpkgs/pkgs/data/fonts/vazir-fonts/default.nix
diff --git a/nixpkgs/pkgs/data/themes/nordic/default.nix b/nixpkgs/pkgs/data/themes/nordic/default.nix
index 8d977671fe7d..c8e956c3f83d 100644
--- a/nixpkgs/pkgs/data/themes/nordic/default.nix
+++ b/nixpkgs/pkgs/data/themes/nordic/default.nix
@@ -3,6 +3,7 @@
 , fetchFromGitHub
 , gtk-engine-murrine
 , jdupes
+, libsForQt5
 }:
 
 stdenv.mkDerivation rec {
@@ -79,6 +80,15 @@ stdenv.mkDerivation rec {
 
   nativeBuildInputs = [ jdupes ];
 
+  buildInputs = with libsForQt5; [
+    plasma-framework
+    qtgraphicaleffects
+    plasma-workspace
+    breeze-icons
+  ];
+
+  dontWrapQtApps = true;
+
   propagatedUserEnvPkgs = [ gtk-engine-murrine ];
 
   installPhase = ''
diff --git a/nixpkgs/pkgs/data/themes/orchis-theme/default.nix b/nixpkgs/pkgs/data/themes/orchis-theme/default.nix
index 2d07ac3ae380..351c1c22207c 100644
--- a/nixpkgs/pkgs/data/themes/orchis-theme/default.nix
+++ b/nixpkgs/pkgs/data/themes/orchis-theme/default.nix
@@ -26,13 +26,13 @@ lib.checkListOfEnum "${pname}: theme tweaks" validTweaks tweaks
 stdenvNoCC.mkDerivation
 rec {
   inherit pname;
-  version = "2023-05-27";
+  version = "2023-10-20";
 
   src = fetchFromGitHub {
     repo = "Orchis-theme";
     owner = "vinceliuice";
     rev = version;
-    hash = "sha256-I1a8y9dAJqFgnhyMqfupSdGvbbScf6tSYKlAhAzY4Dk=";
+    hash = "sha256-GhSzTtbuvbAuXxKNm29sJX5kXE2s2jMDB6Ww6Q7GNSo=";
   };
 
   nativeBuildInputs = [ gtk3 sassc ];
diff --git a/nixpkgs/pkgs/development/compilers/flix/default.nix b/nixpkgs/pkgs/development/compilers/flix/default.nix
index 47a84a6e5f2d..9ce582623fe1 100644
--- a/nixpkgs/pkgs/development/compilers/flix/default.nix
+++ b/nixpkgs/pkgs/development/compilers/flix/default.nix
@@ -2,11 +2,11 @@
 
 stdenvNoCC.mkDerivation rec {
   pname = "flix";
-  version = "0.40.0";
+  version = "0.41.0";
 
   src = fetchurl {
     url = "https://github.com/flix/flix/releases/download/v${version}/flix.jar";
-    sha256 = "sha256-NVQY2TgIR9ROy4x8PWxCjuaOkNx0bcUA4oZHjpQbHc4=";
+    sha256 = "sha256-bDeqwk+grkCxmGE9H8Ks7Q8KvLxNCzaLe44DlR6E7YE=";
   };
 
   dontUnpack = true;
diff --git a/nixpkgs/pkgs/development/compilers/mrustc/default.nix b/nixpkgs/pkgs/development/compilers/mrustc/default.nix
index 6570199f8523..eae17cbce91f 100644
--- a/nixpkgs/pkgs/development/compilers/mrustc/default.nix
+++ b/nixpkgs/pkgs/development/compilers/mrustc/default.nix
@@ -4,9 +4,9 @@
 }:
 
 let
-  version = "0.10";
+  version = "0.10.1";
   tag = "v${version}";
-  rev = "b364724f15fd6fce8234ad8add68107c23a22151";
+  rev = "b6754f574f8846eb842feba4ccbeeecb10bdfacc";
 in
 
 stdenv.mkDerivation rec {
@@ -18,7 +18,7 @@ stdenv.mkDerivation rec {
     owner = "thepowersgang";
     repo = "mrustc";
     rev = tag;
-    sha256 = "0f7kh4n2663sn0z3xib8gzw0s97qpvwag40g2vs3bfjlrbpgi9z0";
+    hash = "sha256-sYnx5dUTaQbK4ugnSzAJwIUwZKPUhThmNA+WlY+LEWc=";
   };
 
   postPatch = ''
diff --git a/nixpkgs/pkgs/development/libraries/argagg/0001-catch.diff b/nixpkgs/pkgs/development/libraries/argagg/0001-catch.diff
deleted file mode 100644
index f99649d56812..000000000000
--- a/nixpkgs/pkgs/development/libraries/argagg/0001-catch.diff
+++ /dev/null
@@ -1,20 +0,0 @@
---- old/test/doctest.h	2019-03-05 18:04:06.143740733 +0300
-+++ new/test/doctest.h	2019-03-05 18:04:43.577284916 +0300
-@@ -1307,7 +1307,7 @@
-                                                        __FILE__, __LINE__, #expr, #as);            \
-             try {                                                                                  \
-                 expr;                                                                              \
--            } catch(as) {                                                                          \
-+            } catch(as e) {                                                                          \
-                 _DOCTEST_RB.m_threw    = true;                                                     \
-                 _DOCTEST_RB.m_threw_as = true;                                                     \
-             } catch(...) { _DOCTEST_RB.m_threw = true; }                                           \
-@@ -1332,7 +1332,7 @@
- #define DOCTEST_REQUIRE_THROWS(expr) DOCTEST_ASSERT_THROWS(expr, DT_REQUIRE_THROWS)
- 
- #define DOCTEST_WARN_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, ex, DT_WARN_THROWS_AS)
--#define DOCTEST_CHECK_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, ex, DT_CHECK_THROWS_AS)
-+#define DOCTEST_CHECK_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, const ex &, DT_CHECK_THROWS_AS)
- #define DOCTEST_REQUIRE_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, ex, DT_REQUIRE_THROWS_AS)
- 
- #define DOCTEST_WARN_NOTHROW(expr) DOCTEST_ASSERT_NOTHROW(expr, DT_WARN_NOTHROW)
diff --git a/nixpkgs/pkgs/development/libraries/duckdb/default.nix b/nixpkgs/pkgs/development/libraries/duckdb/default.nix
index ea152c0cc099..c9f6711780b0 100644
--- a/nixpkgs/pkgs/development/libraries/duckdb/default.nix
+++ b/nixpkgs/pkgs/development/libraries/duckdb/default.nix
@@ -15,13 +15,13 @@ let
 in
 stdenv.mkDerivation rec {
   pname = "duckdb";
-  version = "0.9.0";
+  version = "0.9.1";
 
   src = fetchFromGitHub {
     owner = pname;
     repo = pname;
     rev = "v${version}";
-    hash = "sha256-EKvDH7RwOC4Gu/lturrfnGpzXnJ9azIwAFeuVoa6L/Y=";
+    hash = "sha256-UG/vV/6WxVLq9mdze8pSDFJIekOgGsg93dzMq6eP6Dg=";
   };
 
   patches = [ ./version.patch ];
@@ -106,10 +106,12 @@ stdenv.mkDerivation rec {
     '';
 
   meta = with lib; {
-    homepage = "https://github.com/duckdb/duckdb";
+    changelog = "https://github.com/duckdb/duckdb/releases/tag/v${version}";
     description = "Embeddable SQL OLAP Database Management System";
+    homepage = "https://duckdb.org/";
     license = licenses.mit;
-    platforms = platforms.all;
+    mainProgram = "duckdb";
     maintainers = with maintainers; [ costrouc cpcloud ];
+    platforms = platforms.all;
   };
 }
diff --git a/nixpkgs/pkgs/development/libraries/duckdb/version.patch b/nixpkgs/pkgs/development/libraries/duckdb/version.patch
index 9b368eac5dbc..f40785b43079 100644
--- a/nixpkgs/pkgs/development/libraries/duckdb/version.patch
+++ b/nixpkgs/pkgs/development/libraries/duckdb/version.patch
@@ -56,25 +56,3 @@ index 2b49e11288..0a4a69b9a0 100644
  
  message(STATUS "git hash ${GIT_COMMIT_HASH}, version ${DUCKDB_VERSION}")
  
-diff --git a/tools/pythonpkg/setup.py b/tools/pythonpkg/setup.py
-index fdf2911019..c363cc518a 100644
---- a/tools/pythonpkg/setup.py
-+++ b/tools/pythonpkg/setup.py
-@@ -163,8 +163,6 @@ if 'BUILD_HTTPFS' in os.environ:
- for ext in extensions:
-     toolchain_args.extend(['-DDUCKDB_EXTENSION_{}_LINKED'.format(ext.upper())])
- 
--toolchain_args.extend(['-DDUCKDB_EXTENSION_AUTOLOAD_DEFAULT=1', '-DDUCKDB_EXTENSION_AUTOINSTALL_DEFAULT=1'])
--
- 
- class get_pybind_include(object):
-     def __init__(self, user=False):
-@@ -343,7 +341,7 @@ setup(
-     packages=packages,
-     include_package_data=True,
-     python_requires='>=3.7.0',
--    setup_requires=setup_requires + ["setuptools_scm<7.0.0", 'pybind11>=2.6.0'],
-+    setup_requires=setup_requires + ["setuptools_scm", 'pybind11>=2.6.0'],
-     use_scm_version=setuptools_scm_conf,
-     tests_require=['google-cloud-storage', 'mypy', 'pytest'],
-     classifiers=[
diff --git a/nixpkgs/pkgs/development/libraries/ldb/default.nix b/nixpkgs/pkgs/development/libraries/ldb/default.nix
index 95547fb6382a..de1af1f447e8 100644
--- a/nixpkgs/pkgs/development/libraries/ldb/default.nix
+++ b/nixpkgs/pkgs/development/libraries/ldb/default.nix
@@ -17,11 +17,11 @@
 
 stdenv.mkDerivation rec {
   pname = "ldb";
-  version = "2.7.2";
+  version = "2.8.0";
 
   src = fetchurl {
     url = "mirror://samba/ldb/${pname}-${version}.tar.gz";
-    hash = "sha256-Ju5y1keFTmYtmWQ+srLTQWVavzH0mQg41mUPtc+SCcg=";
+    hash = "sha256-NY3KEPzScgeshXoNf0NaRtvGzR98ENu4QMGTG/GWXwg=";
   };
 
   outputs = [ "out" "dev" ];
diff --git a/nixpkgs/pkgs/development/libraries/libspf2/default.nix b/nixpkgs/pkgs/development/libraries/libspf2/default.nix
index b7bef2973523..997e89b82397 100644
--- a/nixpkgs/pkgs/development/libraries/libspf2/default.nix
+++ b/nixpkgs/pkgs/development/libraries/libspf2/default.nix
@@ -1,23 +1,18 @@
-{ lib, stdenv, fetchFromGitHub, autoreconfHook, fetchpatch }:
+{ lib, stdenv, fetchFromGitHub, autoreconfHook }:
 
 stdenv.mkDerivation rec {
   pname = "libspf2";
-  version = "2.2.12";
+  version = "2.2.13";
 
   src = fetchFromGitHub {
     owner = "helsinki-systems";
     repo = "libspf2";
     rev = "v${version}";
-    sha256 = "03iiaafdcwh220pqignk407h6klrakwz0zkb8iwk6nkwipkwvhsx";
+    hash = "sha256-tkCHP3B1sBb0+scHBjX5lCvaeSrZryfaGKye02LFlYs=";
   };
 
-  patches = [
-    # glibc-2.34 compat
-    (fetchpatch {
-      url = "https://raw.githubusercontent.com/gentoo/gentoo/dbb8a5c9f749cc11e61cfe558f164b165cbc30cb/mail-filter/libspf2/files/libspf2-1.2.11-undefined-dn_.patch";
-      sha256 = "sha256-6JVVkVGCcFJsNeBdVTPcLhW4KoHLY4ai/KXDMliXgPA=";
-    })
-  ];
+  nativeBuildInputs = [ autoreconfHook ];
+  strictDeps = true;
 
   postPatch = ''
     # disable static bins compilation
@@ -28,9 +23,6 @@ stdenv.mkDerivation rec {
       -e '/bin_PROGRAMS/s/spf_example_static//' src/spf_example/Makefile.am
   '';
 
-  # autoreconf necessary because we modified automake files
-  nativeBuildInputs = [ autoreconfHook ];
-
   doCheck = true;
 
   meta = with lib; {
diff --git a/nixpkgs/pkgs/development/libraries/libunarr/default.nix b/nixpkgs/pkgs/development/libraries/libunarr/default.nix
index 1feafabfd4df..c1e0881bf3ff 100644
--- a/nixpkgs/pkgs/development/libraries/libunarr/default.nix
+++ b/nixpkgs/pkgs/development/libraries/libunarr/default.nix
@@ -6,11 +6,11 @@
 
 stdenv.mkDerivation rec {
   pname = "libunarr";
-  version = "1.1.0";
+  version = "1.1.1";
 
   src = fetchurl {
     url = "https://github.com/selmf/unarr/releases/download/v${version}/unarr-${version}.tar.xz";
-    hash = "sha256-5wCnhjoj+GTmaeDTCrUnm1Wt9SsWAbQcPSYM//FNeOA=";
+    hash = "sha256-Mo76BOqZbdOJFrEkeozxdqwpuFyvkhdONNMZmN5BdNI=";
   };
 
   postPatch = lib.optionalString stdenv.isDarwin ''
diff --git a/nixpkgs/pkgs/development/libraries/openxr-loader/default.nix b/nixpkgs/pkgs/development/libraries/openxr-loader/default.nix
index 1abc8a2633c6..53bfa41a8e25 100644
--- a/nixpkgs/pkgs/development/libraries/openxr-loader/default.nix
+++ b/nixpkgs/pkgs/development/libraries/openxr-loader/default.nix
@@ -2,13 +2,13 @@
 
 stdenv.mkDerivation rec {
   pname = "openxr-loader";
-  version = "1.0.30";
+  version = "1.0.31";
 
   src = fetchFromGitHub {
     owner = "KhronosGroup";
     repo = "OpenXR-SDK-Source";
     rev = "release-${version}";
-    sha256 = "sha256-lF8Pauyi+zSNVnpHqq86J3SGUTM6AhFmnT48eyFoYco=";
+    sha256 = "sha256-qK8l/v6nLuMAitz7DfVDjJyVjEmkeD2jgJkG5qOMCcQ=";
   };
 
   nativeBuildInputs = [ cmake python3 pkg-config ];
diff --git a/nixpkgs/pkgs/development/libraries/science/chemistry/tblite/default.nix b/nixpkgs/pkgs/development/libraries/science/chemistry/tblite/default.nix
index 0f05315b9d88..7cc64937dc13 100644
--- a/nixpkgs/pkgs/development/libraries/science/chemistry/tblite/default.nix
+++ b/nixpkgs/pkgs/development/libraries/science/chemistry/tblite/default.nix
@@ -1,6 +1,7 @@
 { stdenv
 , lib
 , fetchFromGitHub
+, fetchpatch
 , cmake
 , gfortran
 , blas
@@ -26,6 +27,14 @@ stdenv.mkDerivation rec {
     hash = "sha256-R7CAFG/x55k5Ieslxeq+DWq1wPip4cI+Yvn1cBbeVNs=";
   };
 
+  patches = [
+    # toml-f 0.4 compatibility
+    (fetchpatch {
+      url = "https://github.com/tblite/tblite/commit/da759fd02b8fbf470a5c6d3df9657cca6b1d0a9a.diff";
+      hash = "sha256-VaeA2VyK+Eas432HMSpJ0lXxHBBNGpfkUO1eHeWpYl0=";
+    })
+  ];
+
   nativeBuildInputs = [ cmake gfortran ];
 
   buildInputs = [
diff --git a/nixpkgs/pkgs/development/libraries/toml-f/default.nix b/nixpkgs/pkgs/development/libraries/toml-f/default.nix
index d28447c40046..696e41ac71cc 100644
--- a/nixpkgs/pkgs/development/libraries/toml-f/default.nix
+++ b/nixpkgs/pkgs/development/libraries/toml-f/default.nix
@@ -8,13 +8,13 @@
 
 stdenv.mkDerivation rec {
   pname = "toml-f";
-  version = "0.3.1";
+  version = "0.4.1";
 
   src = fetchFromGitHub {
     owner = pname;
     repo = pname;
     rev = "v${version}";
-    hash = "sha256-8FbnUkeJUP4fiuJCroAVDo6U2M7ZkFLpG2OYrapMYtU=";
+    hash = "sha256-sCU0uMdcXIA5O964hlK37cOrLTlk1CJeTcWD9FhevOs=";
   };
 
   nativeBuildInputs = [ gfortran cmake ];
diff --git a/nixpkgs/pkgs/development/libraries/virglrenderer/default.nix b/nixpkgs/pkgs/development/libraries/virglrenderer/default.nix
index 42ce297d4563..f64de57fcb89 100644
--- a/nixpkgs/pkgs/development/libraries/virglrenderer/default.nix
+++ b/nixpkgs/pkgs/development/libraries/virglrenderer/default.nix
@@ -1,23 +1,21 @@
-{ lib, stdenv, fetchurl, cmake, meson, ninja, pkg-config, python3
+{ lib, stdenv, fetchurl, meson, ninja, pkg-config, python3
 , libGLU, libepoxy, libX11, libdrm, mesa
 }:
 
 stdenv.mkDerivation rec {
   pname = "virglrenderer";
-  version = "0.10.4";
+  version = "1.0.0";
 
   src = fetchurl {
-    url = "https://gitlab.freedesktop.org/virgl/virglrenderer/-/archive/virglrenderer-${version}/virglrenderer-virglrenderer-${version}.tar.bz2";
-    sha256 = "sha256-qqvnko2sN4bdm9+F0PVjDW5FsiL5k3UAfjPSTqG+73c=";
+    url = "https://gitlab.freedesktop.org/virgl/virglrenderer/-/archive/${version}/virglrenderer-${version}.tar.bz2";
+    hash = "sha256-KMGPP2MeuATHFXKr5oW9HuFOMmmYpmkVLvMvQi0cEdg=";
   };
 
   separateDebugInfo = true;
 
   buildInputs = [ libGLU libepoxy libX11 libdrm mesa ];
 
-  nativeBuildInputs = [ cmake meson ninja pkg-config python3 ];
-
-  dontUseCmakeConfigure = true;
+  nativeBuildInputs = [ meson ninja pkg-config python3 ];
 
   meta = with lib; {
     description = "A virtual 3D GPU library that allows a qemu guest to use the host GPU for accelerated 3D rendering";
diff --git a/nixpkgs/pkgs/development/libraries/zlib-ng/default.nix b/nixpkgs/pkgs/development/libraries/zlib-ng/default.nix
index 3f2ba22ea430..2d3ba583cfd5 100644
--- a/nixpkgs/pkgs/development/libraries/zlib-ng/default.nix
+++ b/nixpkgs/pkgs/development/libraries/zlib-ng/default.nix
@@ -5,13 +5,13 @@
 
 stdenv.mkDerivation rec {
   pname = "zlib-ng";
-  version = "2.1.3";
+  version = "2.1.4";
 
   src = fetchFromGitHub {
     owner = "zlib-ng";
     repo = "zlib-ng";
     rev = version;
-    hash = "sha256-DC4KPPaMuqML0HEhWJmWjyox4WEbExPDfNnpnWzoaHc=";
+    hash = "sha256-okNmobCVAC9y7tjZqFd0DBhOjs3WWRPK8jvK1j9G29k=";
   };
 
   outputs = [ "out" "dev" "bin" ];
diff --git a/nixpkgs/pkgs/development/lua-modules/generated-packages.nix b/nixpkgs/pkgs/development/lua-modules/generated-packages.nix
index 636c411acca4..f344bd948515 100644
--- a/nixpkgs/pkgs/development/lua-modules/generated-packages.nix
+++ b/nixpkgs/pkgs/development/lua-modules/generated-packages.nix
@@ -478,6 +478,30 @@ buildLuarocksPackage {
   };
 }) {};
 
+ferris-nvim = callPackage({ fetchzip, buildLuarocksPackage, lua, luaOlder }:
+buildLuarocksPackage {
+  pname = "ferris.nvim";
+  version = "2.0.0-1";
+  knownRockspec = (fetchurl {
+    url    = "mirror://luarocks/ferris.nvim-2.0.0-1.rockspec";
+    sha256 = "00d3x2hbs8625ky50r2w08c6idcx3bkrk0rks5qd8yh7v61nj53h";
+  }).outPath;
+  src = fetchzip {
+    url    = "https://github.com/mrcjkb/ferris.nvim/archive/2.0.0.zip";
+    sha256 = "1fb18k0ylb06h4ifs9k6lfc42y74xpavzwkqy55lfdkmlbc7jmhy";
+  };
+
+  disabled = (luaOlder "5.1");
+  propagatedBuildInputs = [ lua ];
+
+  meta = {
+    homepage = "https://github.com/mrcjkb/ferris.nvim";
+    description = "Supercharge your Rust experience in Neovim! A heavily modified fork of rust-tools.nvim";
+    maintainers = with lib.maintainers; [ mrcjkb ];
+    license.fullName = "GPL-2.0";
+  };
+}) {};
+
 fifo = callPackage({ fetchzip, lua, buildLuarocksPackage }:
 buildLuarocksPackage {
   pname = "fifo";
diff --git a/nixpkgs/pkgs/development/node-packages/node-packages.json b/nixpkgs/pkgs/development/node-packages/node-packages.json
index 74801b581eaa..f0e9b379f429 100644
--- a/nixpkgs/pkgs/development/node-packages/node-packages.json
+++ b/nixpkgs/pkgs/development/node-packages/node-packages.json
@@ -166,6 +166,7 @@
 , "markdown-link-check"
 , "mastodon-bot"
 , "mathjax"
+, "mathjax-node-cli"
 , "meat"
 , "mocha"
 , "multi-file-swagger"
diff --git a/nixpkgs/pkgs/development/node-packages/node-packages.nix b/nixpkgs/pkgs/development/node-packages/node-packages.nix
index 2035839ec0fa..2686f65e3b21 100644
--- a/nixpkgs/pkgs/development/node-packages/node-packages.nix
+++ b/nixpkgs/pkgs/development/node-packages/node-packages.nix
@@ -19057,6 +19057,15 @@ let
         sha512 = "0yayqDxWQbqk3ojkYqUKqaAQ6AfNKeKWRNA8kR0WXzAsdHpP4BIaOmMAG87JGuO6qcobyW4GjxHd9PmhEd+T9w==";
       };
     };
+    "cliui-4.1.0" = {
+      name = "cliui";
+      packageName = "cliui";
+      version = "4.1.0";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/cliui/-/cliui-4.1.0.tgz";
+        sha512 = "4FG+RSG9DL7uEwRUZXZn3SS34DiDPfzP0VOiEwtUWlE+AR2EIg+hSyvrIgUUfhdgR/UkAeW2QHgeP+hWrXs7jQ==";
+      };
+    };
     "cliui-5.0.0" = {
       name = "cliui";
       packageName = "cliui";
@@ -32416,6 +32425,15 @@ let
         sha512 = "xgs2NH9AE66ucSq4cNG1nhSFghr5l6tdL15Pk+jl46bmmBapgoaY/AacXyaDznAqmGL99TiLSQgO/XazFSKYeQ==";
       };
     };
+    "invert-kv-2.0.0" = {
+      name = "invert-kv";
+      packageName = "invert-kv";
+      version = "2.0.0";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/invert-kv/-/invert-kv-2.0.0.tgz";
+        sha512 = "wPVv/y/QQ/Uiirj/vh3oP+1Ww+AWehmi1g5fFWGPF6IpCBCDVrhgHRMvrLfdYcwDh3QJbGXDW4JAuzxElLSqKA==";
+      };
+    };
     "iota-array-1.0.0" = {
       name = "iota-array";
       packageName = "iota-array";
@@ -34720,6 +34738,15 @@ let
         sha512 = "SdRK2C7jjs4k/kT2mwtO07KJN9RnjxtKn03d9JVj6c3j9WwaLcFYsICYDnLAzY0hp+wG2nxl+Cm2jWLiNVYb8g==";
       };
     };
+    "jsdom-11.12.0" = {
+      name = "jsdom";
+      packageName = "jsdom";
+      version = "11.12.0";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/jsdom/-/jsdom-11.12.0.tgz";
+        sha512 = "y8Px43oyiBM13Zc1z780FrfNLJCXTL40EWlty/LXUtcjykRBNgLlCjWXpfSPBl2iv+N7koQN+dvqszHZgT/Fjw==";
+      };
+    };
     "jsdom-14.1.0" = {
       name = "jsdom";
       packageName = "jsdom";
@@ -35917,6 +35944,15 @@ let
         sha512 = "YiGkH6EnGrDGqLMITnGjXtGmNtjoXw9SVUzcaos8RBi7Ps0VBylkq+vOcY9QE5poLasPCR849ucFUkl0UzUyOw==";
       };
     };
+    "lcid-2.0.0" = {
+      name = "lcid";
+      packageName = "lcid";
+      version = "2.0.0";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/lcid/-/lcid-2.0.0.tgz";
+        sha512 = "avPEb8P8EGnwXKClwsNUgryVjllcRqtMYa49NTsbQagYuT1DcXnl1915oxWjoyGrXR6zH/Y0Zc96xWsPcoDKeA==";
+      };
+    };
     "ldap-filter-0.3.3" = {
       name = "ldap-filter";
       packageName = "ldap-filter";
@@ -35971,6 +36007,15 @@ let
         sha512 = "IpSVCk9AYvLHo5ctcIXxOBpMWUe+4TKN3VPWAKUbJikkmsGp0VrSM8IttVc32D6J4WUsiPE6aEFRNmIoF/gdow==";
       };
     };
+    "left-pad-1.3.0" = {
+      name = "left-pad";
+      packageName = "left-pad";
+      version = "1.3.0";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/left-pad/-/left-pad-1.3.0.tgz";
+        sha512 = "XI5MPzVNApjAyhQzphX8BkmKsKUxD4LdyK24iZeQGinBN9yTQT3bFlCBy/aVx2HrNcqQGsdot8ghrjyrvMCoEA==";
+      };
+    };
     "less-4.2.0" = {
       name = "less";
       packageName = "less";
@@ -38528,6 +38573,33 @@ let
         sha512 = "rUxjysqif/BZQH2yhd5Aaq7vXMSx9NdEsQcyA07uEzIvxgI7zIr33gGsh+RU0/XjmQpCW7RsVof1vlkvQVCK5A==";
       };
     };
+    "mathjax-2.7.9" = {
+      name = "mathjax";
+      packageName = "mathjax";
+      version = "2.7.9";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/mathjax/-/mathjax-2.7.9.tgz";
+        sha512 = "NOGEDTIM9+MrsqnjPEjVGNx4q0GQxqm61yQwSK+/5S59i26wId5IC5gNu9/bu8+CCVl5p9G2IHcAl/wJa+5+BQ==";
+      };
+    };
+    "mathjax-node-2.1.1" = {
+      name = "mathjax-node";
+      packageName = "mathjax-node";
+      version = "2.1.1";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/mathjax-node/-/mathjax-node-2.1.1.tgz";
+        sha512 = "i29tvqD8yHPB2WhrGV5rvliYnKwTT8a/TO8SCnuYtatpSHxLGy3aF7lDTVLD6B1bfuVMTFB6McZu2TBxk0XGeg==";
+      };
+    };
+    "mathjax-node-sre-3.0.3" = {
+      name = "mathjax-node-sre";
+      packageName = "mathjax-node-sre";
+      version = "3.0.3";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/mathjax-node-sre/-/mathjax-node-sre-3.0.3.tgz";
+        sha512 = "SBwqD3DEgdYyPQv7vUBqH/uCr0eOI23PbffzmhelFPY8KdVANZkE2hssJA0Dfl23y7uEefsoVOryckMLEmmzaw==";
+      };
+    };
     "mathml-tag-names-2.1.3" = {
       name = "mathml-tag-names";
       packageName = "mathml-tag-names";
@@ -43272,6 +43344,15 @@ let
         sha512 = "PRT7ZORmwu2MEFt4/fv3Q+mEfN4zetKxufQrkShY2oGvUms9r8otu5HfdyIFHkYXjO7laNsoVGmM2MANfuTA8g==";
       };
     };
+    "os-locale-3.1.0" = {
+      name = "os-locale";
+      packageName = "os-locale";
+      version = "3.1.0";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/os-locale/-/os-locale-3.1.0.tgz";
+        sha512 = "Z8l3R4wYWM40/52Z+S265okfFj8Kt2cC2MKY+xNi3kFs+XGI7WXu/I309QQQYbRW4ijiZ+yxs9pqEhJh0DqW3Q==";
+      };
+    };
     "os-paths-4.4.0" = {
       name = "os-paths";
       packageName = "os-paths";
@@ -44271,6 +44352,15 @@ let
         sha512 = "rgO9Zg5LLLkfJF9E6CCmXlSE4UVceloys8JrFqCcHloC3usd/kJCyPDwH2SOlzix2j3xaP9sUX3e8+kvkuleAA==";
       };
     };
+    "parse5-4.0.0" = {
+      name = "parse5";
+      packageName = "parse5";
+      version = "4.0.0";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/parse5/-/parse5-4.0.0.tgz";
+        sha512 = "VrZ7eOd3T1Fk4XWNXMgiGBK/z0MG48BWG2uQNU4I72fkQuKUTZpl+u9k+CxEG0twMVzSmXEEz12z5Fnw1jIQFA==";
+      };
+    };
     "parse5-5.1.0" = {
       name = "parse5";
       packageName = "parse5";
@@ -52254,6 +52344,15 @@ let
         sha512 = "1klA3Gi5PD1Wv9Q0wUoOQN1IWAuPu0D1U03ThXTr0cJ20+/iq2tHSDnK7Kk/0LXJ1ztUB2/1Os0wKmfyNgUQfg==";
       };
     };
+    "speech-rule-engine-2.4.0" = {
+      name = "speech-rule-engine";
+      packageName = "speech-rule-engine";
+      version = "2.4.0";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/speech-rule-engine/-/speech-rule-engine-2.4.0.tgz";
+        sha512 = "7IXDmpGiQOJWUPVy/rcayqi1aTCrhcQ/bVACu2oyueEuiYzPW8GebYRF4LeyMROL/E0kxkO5U66t0aFWCv0QCQ==";
+      };
+    };
     "speed-limiter-1.0.2" = {
       name = "speed-limiter";
       packageName = "speed-limiter";
@@ -59455,6 +59554,15 @@ let
         sha512 = "saE57nupxk6v3HY35+jzBwYa0rKSy0XR8JSxZPwgLr7ys0IBzhGviA1/TUGJLmSVqs8pb9AnvICXEuOHLprYTw==";
       };
     };
+    "whatwg-url-6.5.0" = {
+      name = "whatwg-url";
+      packageName = "whatwg-url";
+      version = "6.5.0";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/whatwg-url/-/whatwg-url-6.5.0.tgz";
+        sha512 = "rhRZRqx/TLJQWUpQ6bmrt2UV4f0HCQ463yQuONJqC6fO2VoEb1pTYddbe59SkYq87aoM5A3bdhMZiUiVws+fzQ==";
+      };
+    };
     "whatwg-url-7.1.0" = {
       name = "whatwg-url";
       packageName = "whatwg-url";
@@ -59590,6 +59698,15 @@ let
         sha512 = "qe9UWWpkeG5yzZ0tNYxDmd7vo58HDBc39mZ0xWWpolAGADdFOzkfamWLDxkOWcvHQKVmdTyQdLD4NOfjLWTKew==";
       };
     };
+    "wicked-good-xpath-1.3.0" = {
+      name = "wicked-good-xpath";
+      packageName = "wicked-good-xpath";
+      version = "1.3.0";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/wicked-good-xpath/-/wicked-good-xpath-1.3.0.tgz";
+        sha512 = "Gd9+TUn5nXdwj/hFsPVx5cuHHiF5Bwuc30jZ4+ronF1qHK5O7HD0sgmXWSEgwKquT3ClLoKPVbO6qGwVwLzvAw==";
+      };
+    };
     "wide-align-1.1.5" = {
       name = "wide-align";
       packageName = "wide-align";
@@ -60094,6 +60211,15 @@ let
         sha512 = "61a+9LgtYZxTq1hAonhX8Xwpo2riK4IOR/BIVxioFbCfc3QFKmpE4x9dLExfLHKtUfVZigYa36tThVhO57erEw==";
       };
     };
+    "ws-5.2.3" = {
+      name = "ws";
+      packageName = "ws";
+      version = "5.2.3";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/ws/-/ws-5.2.3.tgz";
+        sha512 = "jZArVERrMsKUatIdnLzqvcfydI85dvd/Fp1u/VOpfdDWQ4c9qWXe+VIeAbQ5FrDwciAkr+lzofXLz3Kuf26AOA==";
+      };
+    };
     "ws-6.1.4" = {
       name = "ws";
       packageName = "ws";
@@ -60472,6 +60598,15 @@ let
         sha512 = "yS2uJflVQs6n+CyjHoaBmVSqIDevTAWrzMmjG1Gc7h1qQ7uVozNhEPJAwZXWyGQ/Gafo3fCwrcaokezLPupVyQ==";
       };
     };
+    "xmldom-sre-0.1.31" = {
+      name = "xmldom-sre";
+      packageName = "xmldom-sre";
+      version = "0.1.31";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/xmldom-sre/-/xmldom-sre-0.1.31.tgz";
+        sha512 = "f9s+fUkX04BxQf+7mMWAp5zk61pciie+fFLC9hX9UVvCeJQfNHRHXpeo5MPcR0EUf57PYLdt+ZO4f3Ipk2oZUw==";
+      };
+    };
     "xmlhttprequest-https://github.com/LearnBoost/node-XMLHttpRequest/archive/0f36d0b5ebc03d85f860d42a64ae9791e1daa433.tar.gz" = {
       name = "xmlhttprequest";
       packageName = "xmlhttprequest";
@@ -60680,6 +60815,15 @@ let
         sha512 = "C/FsVVhht4iPQYXOInoxUM/1ELSf9EsgKH34FofQOp6hwCPrW4vG4w5++TED3xRUo8gD7l0P1J1dLlDYzODsTQ==";
       };
     };
+    "yargs-12.0.5" = {
+      name = "yargs";
+      packageName = "yargs";
+      version = "12.0.5";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/yargs/-/yargs-12.0.5.tgz";
+        sha512 = "Lhz8TLaYnxq/2ObqHDql8dX8CJi97oHxrjUcYtzKbbykPtVW9WB+poxI+NM2UIzsMgNCZTIf0AQwsjK5yMAqZw==";
+      };
+    };
     "yargs-13.3.2" = {
       name = "yargs";
       packageName = "yargs";
@@ -60788,6 +60932,15 @@ let
         sha512 = "VCIyR1wJoEBZUqk5PA+oOBF6ypbwh5aNB3I50guxAL/quggdfs4TtNHQrSazFA3fYZ+tEqfs0zIGlv0c/rgjbQ==";
       };
     };
+    "yargs-parser-11.1.1" = {
+      name = "yargs-parser";
+      packageName = "yargs-parser";
+      version = "11.1.1";
+      src = fetchurl {
+        url = "https://registry.npmjs.org/yargs-parser/-/yargs-parser-11.1.1.tgz";
+        sha512 = "C6kB/WJDiaxONLJQnF8ccx9SEeoTTLek8RVbaOIsrAUS8VrBEXfmeSnCZxygc+XC2sNMBIwOOnfcxiynjHsVSQ==";
+      };
+    };
     "yargs-parser-13.1.2" = {
       name = "yargs-parser";
       packageName = "yargs-parser";
@@ -86065,6 +86218,212 @@ in
     bypassCache = true;
     reconstructLock = true;
   };
+  mathjax-node-cli = nodeEnv.buildNodePackage {
+    name = "mathjax-node-cli";
+    packageName = "mathjax-node-cli";
+    version = "1.0.1";
+    src = fetchurl {
+      url = "https://registry.npmjs.org/mathjax-node-cli/-/mathjax-node-cli-1.0.1.tgz";
+      sha512 = "p1OB9zalQZkKYumfx+8mSX59MysF2Ox2H88gHSUQpdjpuMISwIPfw0MQmsvcS00hntSX05uEDa3uzo+1SgSk5w==";
+    };
+    dependencies = [
+      sources."abab-2.0.6"
+      sources."acorn-5.7.4"
+      (sources."acorn-globals-4.3.4" // {
+        dependencies = [
+          sources."acorn-6.4.2"
+        ];
+      })
+      sources."acorn-walk-6.2.0"
+      sources."ajv-6.12.6"
+      sources."ansi-regex-3.0.1"
+      sources."ansi-styles-4.3.0"
+      sources."array-equal-1.0.0"
+      sources."asn1-0.2.6"
+      sources."assert-plus-1.0.0"
+      sources."async-limiter-1.0.1"
+      sources."asynckit-0.4.0"
+      sources."aws-sign2-0.7.0"
+      sources."aws4-1.12.0"
+      sources."bcrypt-pbkdf-1.0.2"
+      sources."browser-process-hrtime-1.0.0"
+      sources."camelcase-5.3.1"
+      sources."caseless-0.12.0"
+      sources."cliui-4.1.0"
+      sources."code-point-at-1.1.0"
+      sources."color-convert-2.0.1"
+      sources."color-name-1.1.4"
+      sources."combined-stream-1.0.8"
+      sources."commander-11.0.0"
+      sources."core-util-is-1.0.2"
+      sources."cross-spawn-6.0.5"
+      sources."cssom-0.3.8"
+      sources."cssstyle-1.4.0"
+      sources."dashdash-1.14.1"
+      (sources."data-urls-1.1.0" // {
+        dependencies = [
+          sources."whatwg-url-7.1.0"
+        ];
+      })
+      sources."decamelize-1.2.0"
+      sources."deep-is-0.1.4"
+      sources."delayed-stream-1.0.0"
+      sources."domexception-1.0.1"
+      sources."ecc-jsbn-0.1.2"
+      sources."emoji-regex-8.0.0"
+      sources."end-of-stream-1.4.4"
+      sources."escalade-3.1.1"
+      sources."escodegen-1.14.3"
+      sources."esprima-4.0.1"
+      sources."estraverse-4.3.0"
+      sources."esutils-2.0.3"
+      sources."execa-1.0.0"
+      sources."extend-3.0.2"
+      sources."extsprintf-1.3.0"
+      sources."fast-deep-equal-3.1.3"
+      sources."fast-json-stable-stringify-2.1.0"
+      sources."fast-levenshtein-2.0.6"
+      sources."find-up-3.0.0"
+      sources."forever-agent-0.6.1"
+      sources."form-data-2.3.3"
+      sources."get-caller-file-1.0.3"
+      sources."get-stream-4.1.0"
+      sources."getpass-0.1.7"
+      sources."har-schema-2.0.0"
+      sources."har-validator-5.1.5"
+      sources."html-encoding-sniffer-1.0.2"
+      sources."http-signature-1.2.0"
+      sources."iconv-lite-0.4.24"
+      sources."invert-kv-2.0.0"
+      sources."is-fullwidth-code-point-2.0.0"
+      sources."is-stream-1.1.0"
+      sources."is-typedarray-1.0.0"
+      sources."isexe-2.0.0"
+      sources."isstream-0.1.2"
+      sources."jsbn-0.1.1"
+      sources."jsdom-11.12.0"
+      sources."json-schema-0.4.0"
+      sources."json-schema-traverse-0.4.1"
+      sources."json-stringify-safe-5.0.1"
+      sources."jsprim-1.4.2"
+      sources."lcid-2.0.0"
+      sources."left-pad-1.3.0"
+      sources."levn-0.3.0"
+      sources."locate-path-3.0.0"
+      sources."lodash-4.17.21"
+      sources."lodash.sortby-4.7.0"
+      sources."map-age-cleaner-0.1.3"
+      sources."mathjax-2.7.9"
+      sources."mathjax-node-2.1.1"
+      (sources."mathjax-node-sre-3.0.3" // {
+        dependencies = [
+          sources."yargs-12.0.5"
+        ];
+      })
+      sources."mem-4.3.0"
+      sources."mime-db-1.52.0"
+      sources."mime-types-2.1.35"
+      sources."mimic-fn-2.1.0"
+      sources."nice-try-1.0.5"
+      sources."npm-run-path-2.0.2"
+      sources."number-is-nan-1.0.1"
+      sources."nwsapi-2.2.7"
+      sources."oauth-sign-0.9.0"
+      sources."once-1.4.0"
+      sources."optionator-0.8.3"
+      sources."os-locale-3.1.0"
+      sources."p-defer-1.0.0"
+      sources."p-finally-1.0.0"
+      sources."p-is-promise-2.1.0"
+      sources."p-limit-2.3.0"
+      sources."p-locate-3.0.0"
+      sources."p-try-2.2.0"
+      sources."parse5-4.0.0"
+      sources."path-exists-3.0.0"
+      sources."path-key-2.0.1"
+      sources."performance-now-2.1.0"
+      sources."pn-1.1.0"
+      sources."prelude-ls-1.1.2"
+      sources."psl-1.9.0"
+      sources."pump-3.0.0"
+      sources."punycode-2.3.0"
+      sources."qs-6.5.3"
+      sources."request-2.88.2"
+      sources."request-promise-core-1.1.4"
+      sources."request-promise-native-1.0.9"
+      sources."require-directory-2.1.1"
+      sources."require-main-filename-1.0.1"
+      sources."safe-buffer-5.2.1"
+      sources."safer-buffer-2.1.2"
+      sources."sax-1.3.0"
+      sources."semver-5.7.2"
+      sources."set-blocking-2.0.0"
+      sources."shebang-command-1.2.0"
+      sources."shebang-regex-1.0.0"
+      sources."signal-exit-3.0.7"
+      sources."source-map-0.6.1"
+      sources."speech-rule-engine-2.4.0"
+      sources."sshpk-1.17.0"
+      sources."stealthy-require-1.1.1"
+      sources."string-width-2.1.1"
+      sources."strip-ansi-4.0.0"
+      sources."strip-eof-1.0.0"
+      sources."symbol-tree-3.2.4"
+      sources."tough-cookie-2.5.0"
+      sources."tr46-1.0.1"
+      sources."tunnel-agent-0.6.0"
+      sources."tweetnacl-0.14.5"
+      sources."type-check-0.3.2"
+      sources."uri-js-4.4.1"
+      sources."uuid-3.4.0"
+      sources."verror-1.10.0"
+      sources."w3c-hr-time-1.0.2"
+      sources."webidl-conversions-4.0.2"
+      sources."whatwg-encoding-1.0.5"
+      sources."whatwg-mimetype-2.3.0"
+      sources."whatwg-url-6.5.0"
+      sources."which-1.3.1"
+      sources."which-module-2.0.1"
+      sources."wicked-good-xpath-1.3.0"
+      sources."word-wrap-1.2.5"
+      (sources."wrap-ansi-2.1.0" // {
+        dependencies = [
+          sources."ansi-regex-2.1.1"
+          sources."is-fullwidth-code-point-1.0.0"
+          sources."string-width-1.0.2"
+          sources."strip-ansi-3.0.1"
+        ];
+      })
+      sources."wrappy-1.0.2"
+      sources."ws-5.2.3"
+      sources."xml-name-validator-3.0.0"
+      sources."xmldom-sre-0.1.31"
+      sources."y18n-4.0.3"
+      (sources."yargs-17.7.2" // {
+        dependencies = [
+          sources."ansi-regex-5.0.1"
+          sources."cliui-8.0.1"
+          sources."get-caller-file-2.0.5"
+          sources."is-fullwidth-code-point-3.0.0"
+          sources."string-width-4.2.3"
+          sources."strip-ansi-6.0.1"
+          sources."wrap-ansi-7.0.0"
+          sources."y18n-5.0.8"
+          sources."yargs-parser-21.1.1"
+        ];
+      })
+      sources."yargs-parser-11.1.1"
+    ];
+    buildInputs = globalBuildInputs;
+    meta = {
+      description = "CLI tools for calling mathjax-node";
+      homepage = "https://github.com/mathjax/mathjax-node-cli#readme";
+      license = "Apache-2.0";
+    };
+    production = true;
+    bypassCache = true;
+    reconstructLock = true;
+  };
   meat = nodeEnv.buildNodePackage {
     name = "meat";
     packageName = "meat";
diff --git a/nixpkgs/pkgs/development/php-packages/opentelemetry/default.nix b/nixpkgs/pkgs/development/php-packages/opentelemetry/default.nix
index 2bef82d8d8e9..346a3cb36951 100644
--- a/nixpkgs/pkgs/development/php-packages/opentelemetry/default.nix
+++ b/nixpkgs/pkgs/development/php-packages/opentelemetry/default.nix
@@ -1,7 +1,7 @@
 { lib, buildPecl, fetchFromGitHub }:
 
 let
-  version = "1.0.0RC2";
+  version = "1.0.0RC3";
 in buildPecl {
   inherit version;
   pname = "opentelemetry";
@@ -10,7 +10,7 @@ in buildPecl {
     owner = "open-telemetry";
     repo = "opentelemetry-php-instrumentation";
     rev = version;
-    hash = "sha256-sCsJ4ZmQXTTG+ZxDzw3b6Su/8QUAVZv7vV6SuLBET+0=";
+    hash = "sha256-0jHXl+Amjv0vLSuSWhkGAU25pkRXbJgdx02N6o2dUyw=";
   };
 
   sourceRoot = "source/ext";
diff --git a/nixpkgs/pkgs/development/python-modules/aioairzone-cloud/default.nix b/nixpkgs/pkgs/development/python-modules/aioairzone-cloud/default.nix
index bdc21d70892f..2108555b0d33 100644
--- a/nixpkgs/pkgs/development/python-modules/aioairzone-cloud/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/aioairzone-cloud/default.nix
@@ -9,7 +9,7 @@
 
 buildPythonPackage rec {
   pname = "aioairzone-cloud";
-  version = "0.2.4";
+  version = "0.2.7";
   format = "pyproject";
 
   disabled = pythonOlder "3.7";
@@ -18,7 +18,7 @@ buildPythonPackage rec {
     owner = "Noltari";
     repo = "aioairzone-cloud";
     rev = "refs/tags/${version}";
-    hash = "sha256-7sjiY20jDUHtEnqAMwEHsBboK9XCH5XjE0sHR82YvEA=";
+    hash = "sha256-v6cK4j16BhTqjdc5J9XQWGFCa1r9f0/dto9teVTNn0c=";
   };
 
   nativeBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/aioairzone/default.nix b/nixpkgs/pkgs/development/python-modules/aioairzone/default.nix
index ac094571d087..39c12ac6e2c0 100644
--- a/nixpkgs/pkgs/development/python-modules/aioairzone/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/aioairzone/default.nix
@@ -8,7 +8,7 @@
 
 buildPythonPackage rec {
   pname = "aioairzone";
-  version = "0.6.8";
+  version = "0.6.9";
   format = "pyproject";
 
   disabled = pythonOlder "3.11";
@@ -17,7 +17,7 @@ buildPythonPackage rec {
     owner = "Noltari";
     repo = pname;
     rev = "refs/tags/${version}";
-    hash = "sha256-aCf0IO70t/QMmDmIwBKN3Um1HgHjHn1r6Dze/pWaQ5M=";
+    hash = "sha256-0nbH0pnTYRuSOkzG5Yn/fJmRKtXBMd6ti6Z+AW72j3Q=";
   };
 
   nativeBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/aioelectricitymaps/default.nix b/nixpkgs/pkgs/development/python-modules/aioelectricitymaps/default.nix
new file mode 100644
index 000000000000..502363de13c3
--- /dev/null
+++ b/nixpkgs/pkgs/development/python-modules/aioelectricitymaps/default.nix
@@ -0,0 +1,55 @@
+{ lib
+, aiohttp
+, aresponses
+, buildPythonPackage
+, dataclasses-json
+, fetchFromGitHub
+, poetry-core
+, pytest-asyncio
+, pytestCheckHook
+, pythonOlder
+, syrupy
+}:
+
+buildPythonPackage rec {
+  pname = "aioelectricitymaps";
+  version = "0.1.3";
+  pyproject = true;
+
+  disabled = pythonOlder "3.10";
+
+  src = fetchFromGitHub {
+    owner = "jpbede";
+    repo = "aioelectricitymaps";
+    rev = "refs/tags/v${version}";
+    hash = "sha256-2Ou3obpGRJ/iUPuaoBGlmDTJLx6+S8ivK9PbrbSvYyg=";
+  };
+
+  nativeBuildInputs = [
+    poetry-core
+  ];
+
+  propagatedBuildInputs = [
+    aiohttp
+    dataclasses-json
+  ];
+
+  nativeCheckInputs = [
+    aresponses
+    pytest-asyncio
+    pytestCheckHook
+    syrupy
+  ];
+
+  pythonImportsCheck = [
+    "aioelectricitymaps"
+  ];
+
+  meta = with lib; {
+    description = "Module for interacting with Electricity maps";
+    homepage = "https://github.com/jpbede/aioelectricitymaps";
+    changelog = "https://github.com/jpbede/aioelectricitymaps/releases/tag/v${version}";
+    license = licenses.mit;
+    maintainers = with maintainers; [ fab ];
+  };
+}
diff --git a/nixpkgs/pkgs/development/python-modules/aioesphomeapi/default.nix b/nixpkgs/pkgs/development/python-modules/aioesphomeapi/default.nix
index 79ef028fd36e..c77a4dfadda5 100644
--- a/nixpkgs/pkgs/development/python-modules/aioesphomeapi/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/aioesphomeapi/default.nix
@@ -14,7 +14,7 @@
 
 buildPythonPackage rec {
   pname = "aioesphomeapi";
-  version = "17.2.0";
+  version = "18.0.7";
   format = "setuptools";
 
   disabled = pythonOlder "3.9";
@@ -23,7 +23,7 @@ buildPythonPackage rec {
     owner = "esphome";
     repo = pname;
     rev = "refs/tags/v${version}";
-    hash = "sha256-+yPHIXJ0vHaFO2X3xN+7WIQUlCvoYlGi1N7W+H/ng/0=";
+    hash = "sha256-Jgu9NEFY74Z0mZ2Cz4uaHG0gfywa2nF/H8G1j9YAyrw=";
   };
 
   propagatedBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/async-upnp-client/default.nix b/nixpkgs/pkgs/development/python-modules/async-upnp-client/default.nix
index 03b7e8664c46..c51c99d00f0b 100644
--- a/nixpkgs/pkgs/development/python-modules/async-upnp-client/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/async-upnp-client/default.nix
@@ -15,7 +15,7 @@
 
 buildPythonPackage rec {
   pname = "async-upnp-client";
-  version = "0.36.1";
+  version = "0.36.2";
   format = "setuptools";
 
   disabled = pythonOlder "3.8";
@@ -24,7 +24,7 @@ buildPythonPackage rec {
     owner = "StevenLooman";
     repo = "async_upnp_client";
     rev = "refs/tags/${version}";
-    hash = "sha256-NFSJlBRVgeuhK7IXjNz2g6SbSgveSjaJpSQrxSACG04=";
+    hash = "sha256-f3x5adxLHT/C5dXfdBH6stKv0y2nuhbpe8jkJex1DKU=";
   };
 
   propagatedBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/asyncwhois/default.nix b/nixpkgs/pkgs/development/python-modules/asyncwhois/default.nix
index 25cb21e7e246..e462a0d0b49c 100644
--- a/nixpkgs/pkgs/development/python-modules/asyncwhois/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/asyncwhois/default.nix
@@ -12,7 +12,7 @@
 
 buildPythonPackage rec {
   pname = "asyncwhois";
-  version = "1.0.8";
+  version = "1.0.9";
   format = "setuptools";
 
   disabled = pythonOlder "3.7";
@@ -21,7 +21,7 @@ buildPythonPackage rec {
     owner = "pogzyb";
     repo = "asyncwhois";
     rev = "refs/tags/v${version}";
-    hash = "sha256-fYXxoS4bGTat5QT98ETmWk/VKXJmg9mtkUu02SZT4Eo=";
+    hash = "sha256-5T/h4YzODH7zFyQpG8qVZetTK7V+Ii9jc+MQFgMUA8w=";
   };
 
   propagatedBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/atlassian-python-api/default.nix b/nixpkgs/pkgs/development/python-modules/atlassian-python-api/default.nix
index fd389308c931..fd389308c931 100755..100644
--- a/nixpkgs/pkgs/development/python-modules/atlassian-python-api/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/atlassian-python-api/default.nix
diff --git a/nixpkgs/pkgs/development/python-modules/bimmer-connected/default.nix b/nixpkgs/pkgs/development/python-modules/bimmer-connected/default.nix
index 40f7ad7cf8ab..470eaf376a77 100644
--- a/nixpkgs/pkgs/development/python-modules/bimmer-connected/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/bimmer-connected/default.nix
@@ -17,7 +17,7 @@
 
 buildPythonPackage rec {
   pname = "bimmer-connected";
-  version = "0.14.1";
+  version = "0.14.2";
   format = "setuptools";
 
   disabled = pythonOlder "3.6";
@@ -26,7 +26,7 @@ buildPythonPackage rec {
     owner = "bimmerconnected";
     repo = "bimmer_connected";
     rev = "refs/tags/${version}";
-    hash = "sha256-Fo30qDBqVxVuD/Ow0jsvN20Hx7Zhvie47CE+1ys1ewU=";
+    hash = "sha256-69H0hB+yVmyzJ5A2Cb7ZcaaoRzMt618U+TUHYQ03/cY=";
   };
 
   nativeBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/bleak/default.nix b/nixpkgs/pkgs/development/python-modules/bleak/default.nix
index 61a069305d13..f53f614867ec 100644
--- a/nixpkgs/pkgs/development/python-modules/bleak/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/bleak/default.nix
@@ -25,6 +25,12 @@ buildPythonPackage rec {
     hash = "sha256-T0im8zKyNLbskAEDeUUFS/daJtvttlHlttjscqP8iSk=";
   };
 
+  postPatch = ''
+    # bleak checks BlueZ's version with a call to `bluetoothctl --version`
+    substituteInPlace bleak/backends/bluezdbus/version.py \
+      --replace \"bluetoothctl\" \"${bluez}/bin/bluetoothctl\"
+  '';
+
   nativeBuildInputs = [
     poetry-core
   ];
@@ -40,12 +46,6 @@ buildPythonPackage rec {
     pytestCheckHook
   ];
 
-  postPatch = ''
-    # bleak checks BlueZ's version with a call to `bluetoothctl --version`
-    substituteInPlace bleak/backends/bluezdbus/__init__.py \
-      --replace \"bluetoothctl\" \"${bluez}/bin/bluetoothctl\"
-  '';
-
   pythonImportsCheck = [
     "bleak"
   ];
diff --git a/nixpkgs/pkgs/development/python-modules/cantools/default.nix b/nixpkgs/pkgs/development/python-modules/cantools/default.nix
new file mode 100644
index 000000000000..3cb260dd8d1b
--- /dev/null
+++ b/nixpkgs/pkgs/development/python-modules/cantools/default.nix
@@ -0,0 +1,58 @@
+{ lib
+, buildPythonPackage
+, fetchPypi
+, setuptools-scm
+, argparse-addons
+, bitstruct
+, can
+, crccheck
+, diskcache
+, matplotlib
+, parameterized
+, pytestCheckHook
+, pythonOlder
+, textparser
+}:
+
+buildPythonPackage rec {
+  pname = "cantools";
+  version = "38.0.2";
+  format = "setuptools";
+
+  disabled = pythonOlder "3.7";
+
+  src = fetchPypi {
+    inherit pname version;
+    hash = "sha256-k7/m9L1lLzaXY+qRYrAnpi9CSoQA8kI9QRN5GM5oxo4=";
+  };
+
+  nativeBuildInputs = [
+    setuptools-scm
+  ];
+
+  propagatedBuildInputs = [
+    argparse-addons
+    bitstruct
+    can
+    crccheck
+    diskcache
+    matplotlib
+    textparser
+  ];
+
+  nativeCheckInputs = [
+    parameterized
+    pytestCheckHook
+  ];
+
+  pythonImportsCheck = [
+    "cantools"
+  ];
+
+  meta = with lib; {
+    homepage = "https://github.com/cantools/cantools";
+    description = "CAN bus tools.";
+    license = licenses.mit;
+    maintainers = with maintainers; [ gray-heron ];
+  };
+}
diff --git a/nixpkgs/pkgs/development/python-modules/certbot-dns-ovh/default.nix b/nixpkgs/pkgs/development/python-modules/certbot-dns-ovh/default.nix
new file mode 100644
index 000000000000..da0dd57cff87
--- /dev/null
+++ b/nixpkgs/pkgs/development/python-modules/certbot-dns-ovh/default.nix
@@ -0,0 +1,39 @@
+{ buildPythonPackage
+, acme
+, certbot
+, dns-lexicon
+, pytestCheckHook
+, pythonOlder
+}:
+
+buildPythonPackage rec {
+  pname = "certbot-dns-ovh";
+
+  inherit (certbot) src version;
+  disabled = pythonOlder "3.6";
+
+  sourceRoot = "${src.name}/certbot-dns-ovh";
+
+  propagatedBuildInputs = [
+    acme
+    certbot
+    dns-lexicon
+  ];
+
+  nativeCheckInputs = [
+    pytestCheckHook
+  ];
+
+  pytestFlagsArray = [
+    "-o cache_dir=$(mktemp -d)"
+
+    # Monitor https://github.com/certbot/certbot/issues/9606 for a solution
+    "-W 'ignore:pkg_resources is deprecated as an API:DeprecationWarning'"
+    "-W 'ignore:Package lexicon.providers is deprecated and will be removed in Lexicon 4>=.:DeprecationWarning'"
+    "-W 'ignore:Legacy configuration object has been used to load the ConfigResolver.:DeprecationWarning'"
+  ];
+
+  meta = certbot.meta // {
+    description = "OVH DNS Authenticator plugin for Certbot";
+  };
+}
diff --git a/nixpkgs/pkgs/development/python-modules/dbus-fast/default.nix b/nixpkgs/pkgs/development/python-modules/dbus-fast/default.nix
index b5d2ce8eef71..4394271f7ebd 100644
--- a/nixpkgs/pkgs/development/python-modules/dbus-fast/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/dbus-fast/default.nix
@@ -13,7 +13,7 @@
 
 buildPythonPackage rec {
   pname = "dbus-fast";
-  version = "2.11.1";
+  version = "2.12.0";
   format = "pyproject";
 
   disabled = pythonOlder "3.7";
@@ -22,7 +22,7 @@ buildPythonPackage rec {
     owner = "Bluetooth-Devices";
     repo = pname;
     rev = "refs/tags/v${version}";
-    hash = "sha256-oYBk+Rko5qK1k2TJdDNiN0rWdx7sdy6UpxMlDynKZ9Y=";
+    hash = "sha256-ZeDQn+/b6WBCodZ7Ow5IlC9XlWieAifCMJtM1yse5P8=";
   };
 
   # The project can build both an optimized cython version and an unoptimized
diff --git a/nixpkgs/pkgs/development/python-modules/duckdb/default.nix b/nixpkgs/pkgs/development/python-modules/duckdb/default.nix
index e9aac74d835e..5ff995684992 100644
--- a/nixpkgs/pkgs/development/python-modules/duckdb/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/duckdb/default.nix
@@ -13,17 +13,19 @@
 }:
 
 buildPythonPackage rec {
-  inherit (duckdb) pname version src patches;
+  inherit (duckdb) pname version src;
   format = "setuptools";
 
-  postPatch = ''
+  # 1. let nix control build cores
+  # 2. default to extension autoload & autoinstall disabled
+  # 3. unconstrain setuptools_scm version
+  patches = (duckdb.patches or []) ++ [ ./setup.patch ];
+
+  postPatch = (duckdb.postPatch or "") + ''
     # we can't use sourceRoot otherwise patches don't apply, because the patches apply to the C++ library
     cd tools/pythonpkg
 
-    # 1. let nix control build cores
-    # 2. unconstrain setuptools_scm version
-    substituteInPlace setup.py \
-      --replace "multiprocessing.cpu_count()" "$NIX_BUILD_CORES"
+    substituteInPlace setup.py --subst-var NIX_BUILD_CORES
 
     # avoid dependency on mypy
     rm tests/stubs/test_stubs.py
@@ -54,6 +56,8 @@ buildPythonPackage rec {
   disabledTests = [
     # tries to make http request
     "test_install_non_existent_extension"
+    # test is racy and interrupt can be delivered before or after target point
+    "test_connection_interrupt"
   ];
 
   preCheck = ''
diff --git a/nixpkgs/pkgs/development/python-modules/duckdb/setup.patch b/nixpkgs/pkgs/development/python-modules/duckdb/setup.patch
new file mode 100644
index 000000000000..8c8f790a66a1
--- /dev/null
+++ b/nixpkgs/pkgs/development/python-modules/duckdb/setup.patch
@@ -0,0 +1,30 @@
+diff --git a/tools/pythonpkg/setup.py b/tools/pythonpkg/setup.py
+index 30f1e1ccdd..6784169fcb 100644
+--- a/tools/pythonpkg/setup.py
++++ b/tools/pythonpkg/setup.py
+@@ -96,7 +96,7 @@ def parallel_cpp_compile(
+             return
+         self._compile(obj, src, ext, cc_args, extra_postargs, pp_opts)
+ 
+-    list(multiprocessing.pool.ThreadPool(multiprocessing.cpu_count()).imap(_single_compile, objects))
++    list(multiprocessing.pool.ThreadPool(@NIX_BUILD_CORES@).imap(_single_compile, objects))
+     return objects
+ 
+ 
+@@ -163,7 +163,6 @@ if 'BUILD_HTTPFS' in os.environ:
+ for ext in extensions:
+     toolchain_args.extend(['-DDUCKDB_EXTENSION_{}_LINKED'.format(ext.upper())])
+ 
+-toolchain_args.extend(['-DDUCKDB_EXTENSION_AUTOLOAD_DEFAULT=1', '-DDUCKDB_EXTENSION_AUTOINSTALL_DEFAULT=1'])
+ 
+ 
+ class get_pybind_include(object):
+@@ -348,7 +347,7 @@ setup(
+     packages=packages,
+     include_package_data=True,
+     python_requires='>=3.7.0',
+-    setup_requires=setup_requires + ["setuptools_scm<7.0.0", 'pybind11>=2.6.0'],
++    setup_requires=setup_requires + ["setuptools_scm", 'pybind11>=2.6.0'],
+     use_scm_version=setuptools_scm_conf,
+     tests_require=['google-cloud-storage', 'mypy', 'pytest'],
+     classifiers=[
diff --git a/nixpkgs/pkgs/development/python-modules/elgato/default.nix b/nixpkgs/pkgs/development/python-modules/elgato/default.nix
index 92b4cad66b5c..3aeab819b76a 100644
--- a/nixpkgs/pkgs/development/python-modules/elgato/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/elgato/default.nix
@@ -13,18 +13,25 @@
 
 buildPythonPackage rec {
   pname = "elgato";
-  version = "4.0.1";
+  version = "5.0.0";
   format = "pyproject";
 
-  disabled = pythonOlder "3.9";
+  disabled = pythonOlder "3.11";
 
   src = fetchFromGitHub {
     owner = "frenck";
     repo = "python-elgato";
     rev = "refs/tags/v${version}";
-    hash = "sha256-kyFnc/lMxgYy8s/gAP5vpEPV8a+dphOummr6G7deGQ4=";
+    hash = "sha256-TI5wu2FYVUMvgDkbktcwPLnTSD8XUSy8qwOCdrsiopk=";
   };
 
+  postPatch = ''
+    # Upstream doesn't set a version for the pyproject.toml
+    substituteInPlace pyproject.toml \
+      --replace "0.0.0" "${version}" \
+      --replace "--cov" ""
+  '';
+
   nativeBuildInputs = [
     poetry-core
   ];
@@ -41,13 +48,6 @@ buildPythonPackage rec {
     pytestCheckHook
   ];
 
-  postPatch = ''
-    # Upstream doesn't set a version for the pyproject.toml
-    substituteInPlace pyproject.toml \
-      --replace "0.0.0" "${version}" \
-      --replace "--cov" ""
-  '';
-
   pythonImportsCheck = [
     "elgato"
   ];
@@ -55,6 +55,7 @@ buildPythonPackage rec {
   meta = with lib; {
     description = "Python client for Elgato Key Lights";
     homepage = "https://github.com/frenck/python-elgato";
+    changelog = "https://github.com/frenck/python-elgato/releases/tag/v${version}";
     license = with licenses; [ mit ];
     maintainers = with maintainers; [ fab ];
   };
diff --git a/nixpkgs/pkgs/development/python-modules/fypp/default.nix b/nixpkgs/pkgs/development/python-modules/fypp/default.nix
index 9504a5839e73..a75e141361a8 100644
--- a/nixpkgs/pkgs/development/python-modules/fypp/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/fypp/default.nix
@@ -2,13 +2,13 @@
 
 buildPythonApplication rec {
   pname = "fypp";
-  version = "3.1";
+  version = "3.2";
 
   src = fetchFromGitHub {
     owner = "aradi";
     repo = pname;
     rev = version;
-    hash = "sha256-iog5Gdcd1F230Nl4JDrKoyYr8JualVgNZQzHLzd4xe8=";
+    hash = "sha256-MgGVlOqOIrIVoDfBMVpFLT26mhYndxans2hfo/+jdoA=";
   };
 
   meta = with lib; {
diff --git a/nixpkgs/pkgs/development/python-modules/gpaw/default.nix b/nixpkgs/pkgs/development/python-modules/gpaw/default.nix
index 913f1616a07d..e359c78c66f8 100644
--- a/nixpkgs/pkgs/development/python-modules/gpaw/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/gpaw/default.nix
@@ -74,13 +74,13 @@ let
 
 in buildPythonPackage rec {
   pname = "gpaw";
-  version = "22.8.0";
+  version = "23.9.1";
 
   src = fetchFromGitLab {
     owner = "gpaw";
     repo = pname;
     rev = version;
-    hash = "sha256-Kgf8yuGua7mcGP+jVVmbE8JCsbrfzewRTRt3ihq9YX4=";
+    hash = "sha256-9nnK4ksTFATO6HexnxfMiih/yoY/noyJZXZOaDG/2kc=";
   };
 
   # `inetutils` is required because importing `gpaw`, as part of
diff --git a/nixpkgs/pkgs/development/python-modules/guppy3/default.nix b/nixpkgs/pkgs/development/python-modules/guppy3/default.nix
index c47fb6a80425..65d7c2622a8e 100644
--- a/nixpkgs/pkgs/development/python-modules/guppy3/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/guppy3/default.nix
@@ -7,14 +7,14 @@
 
 buildPythonPackage rec {
   pname = "guppy3";
-  version = "3.1.3";
+  version = "3.1.4";
   disabled = pythonOlder "3.6";
 
   src = fetchFromGitHub {
     owner = "zhuyifei1999";
     repo = pname;
     rev = "v${version}";
-    hash = "sha256-i3WqXlNnNhBVw9rdnxnzQISFkZHBpc/gqG+rxOWPiyc=";
+    hash = "sha256-RMWIP4tVSCCEQpr0kZvsN1HwL6rBcLuubfBl175eSNg=";
   };
 
   propagatedBuildInputs = [ tkinter ];
diff --git a/nixpkgs/pkgs/development/python-modules/moddb/default.nix b/nixpkgs/pkgs/development/python-modules/moddb/default.nix
index 102410dc6bbb..a0205d5c4676 100644
--- a/nixpkgs/pkgs/development/python-modules/moddb/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/moddb/default.nix
@@ -10,14 +10,14 @@
 
 buildPythonPackage rec {
   pname = "moddb";
-  version = "0.8.1";
+  version = "0.9.0";
   format = "setuptools";
 
   src = fetchFromGitHub {
     owner = "ClementJ18";
     repo = "moddb";
     rev = "v${version}";
-    hash = "sha256-Pl/Wc0CL31+ZLFfy6yUfrZzsECifnEpWVGRHZVaFWG4=";
+    hash = "sha256-2t5QQAmSLOrdNCl0XdsFPdP2UF10/qq69DovqeQ1Vt8=";
   };
 
   nativeBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/num2words/default.nix b/nixpkgs/pkgs/development/python-modules/num2words/default.nix
index 82ba5a8cec10..c43cb81eb2fc 100644
--- a/nixpkgs/pkgs/development/python-modules/num2words/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/num2words/default.nix
@@ -7,12 +7,12 @@
 }:
 
 buildPythonPackage rec {
-  version = "0.5.12";
+  version = "0.5.13";
   pname = "num2words";
 
   src = fetchPypi {
     inherit pname version;
-    hash = "sha256-fnwLDwgEBao6HdnTKxypCzvwO6sXuOVNsF4beDAaCYg=";
+    hash = "sha256-owZHFvu/kNdcRJRQzr+8c6ahPmOyUx0JvezDqxoiCc8=";
   };
 
   propagatedBuildInputs = [ docopt ];
diff --git a/nixpkgs/pkgs/development/python-modules/osmnx/default.nix b/nixpkgs/pkgs/development/python-modules/osmnx/default.nix
index fec12037e20b..fec12037e20b 100755..100644
--- a/nixpkgs/pkgs/development/python-modules/osmnx/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/osmnx/default.nix
diff --git a/nixpkgs/pkgs/development/python-modules/peaqevcore/default.nix b/nixpkgs/pkgs/development/python-modules/peaqevcore/default.nix
index 38397535c01f..33e65661f92e 100644
--- a/nixpkgs/pkgs/development/python-modules/peaqevcore/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/peaqevcore/default.nix
@@ -6,14 +6,14 @@
 
 buildPythonPackage rec {
   pname = "peaqevcore";
-  version = "19.5.4";
+  version = "19.5.5";
   format = "setuptools";
 
   disabled = pythonOlder "3.7";
 
   src = fetchPypi {
     inherit pname version;
-    hash = "sha256-AkVUYUZobQsnSfMfciiSbPwo0HCnlO3NLoUA1+wqBt4=";
+    hash = "sha256-AgJT/VfNHcSuJhypBwqJkgXuvYDBlZ7eQp4nGva4z6U=";
   };
 
   postPatch = ''
diff --git a/nixpkgs/pkgs/development/python-modules/persim/default.nix b/nixpkgs/pkgs/development/python-modules/persim/default.nix
index 09feb66549a4..869fb6146f2e 100644
--- a/nixpkgs/pkgs/development/python-modules/persim/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/persim/default.nix
@@ -16,14 +16,14 @@
 
 buildPythonPackage rec {
   pname = "persim";
-  version = "0.3.1";
+  version = "0.3.2";
   format = "setuptools";
 
   disabled = pythonOlder "3.7";
 
   src = fetchPypi {
     inherit pname version;
-    hash = "sha256-7w8KJHrc9hBOysFBF9sLJFgXEOqKjZZIFoBTlXALSXU=";
+    hash = "sha256-p6Vumfr+vRDr0D9PnEZItp9vNlCLIb59HpBg1KdyHGE=";
   };
 
   propagatedBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/plugwise/default.nix b/nixpkgs/pkgs/development/python-modules/plugwise/default.nix
index 8876eea828af..22e0a6282762 100644
--- a/nixpkgs/pkgs/development/python-modules/plugwise/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/plugwise/default.nix
@@ -20,7 +20,7 @@
 
 buildPythonPackage rec {
   pname = "plugwise";
-  version = "0.33.1";
+  version = "0.33.2";
   format = "setuptools";
 
   disabled = pythonOlder "3.7";
@@ -29,7 +29,7 @@ buildPythonPackage rec {
     owner = pname;
     repo = "python-plugwise";
     rev = "refs/tags/v${version}";
-    hash = "sha256-uJBUim5FlS+Jw3rGEKuorksVIgI5tVRAI7tESeYnGUc=";
+    hash = "sha256-WTgv0bEkhLMoRCw6Xh5SlYLxnlQCv603lKTajjCETT4=";
   };
 
   propagatedBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/pvo/default.nix b/nixpkgs/pkgs/development/python-modules/pvo/default.nix
index 6f3f698fe2c7..6963d3700013 100644
--- a/nixpkgs/pkgs/development/python-modules/pvo/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/pvo/default.nix
@@ -13,18 +13,25 @@
 
 buildPythonPackage rec {
   pname = "pvo";
-  version = "1.0.0";
+  version = "2.0.0";
   format = "pyproject";
 
-  disabled = pythonOlder "3.10";
+  disabled = pythonOlder "3.11";
 
   src = fetchFromGitHub {
     owner = "frenck";
     repo = "python-pvoutput";
     rev = "refs/tags/v${version}";
-    hash = "sha256-6oVACUnK8WVlEx047CUXmSXQ0+M3xnSvyMHw5Wttk7M=";
+    hash = "sha256-SvsrvGwIAlj/8hdk90+rxigVrx6n3YInvF/4eux2H04=";
   };
 
+  postPatch = ''
+    # Upstream doesn't set a version for the pyproject.toml
+    substituteInPlace pyproject.toml \
+      --replace "0.0.0" "${version}" \
+      --replace "--cov" ""
+  '';
+
   nativeBuildInputs = [
     poetry-core
   ];
@@ -41,13 +48,6 @@ buildPythonPackage rec {
     pytestCheckHook
   ];
 
-  postPatch = ''
-    # Upstream doesn't set a version for the pyproject.toml
-    substituteInPlace pyproject.toml \
-      --replace "0.0.0" "${version}" \
-      --replace "--cov" ""
-  '';
-
   pythonImportsCheck = [
     "pvo"
   ];
diff --git a/nixpkgs/pkgs/development/python-modules/pyduotecno/default.nix b/nixpkgs/pkgs/development/python-modules/pyduotecno/default.nix
index e61e725a80a1..17fd2d78885c 100644
--- a/nixpkgs/pkgs/development/python-modules/pyduotecno/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/pyduotecno/default.nix
@@ -8,7 +8,7 @@
 
 buildPythonPackage rec {
   pname = "pyduotecno";
-  version = "2023.10.0";
+  version = "2023.10.1";
   format = "pyproject";
 
   disabled = pythonOlder "3.9";
@@ -17,7 +17,7 @@ buildPythonPackage rec {
     owner = "Cereal2nd";
     repo = "pyDuotecno";
     rev = "refs/tags/${version}";
-    hash = "sha256-GxCqWgw4OdhJUMsGzCZnl6KYH7HQpGyV7zXMxbShHlg=";
+    hash = "sha256-fDooQb1i9rgzDZBzZ+lYb0WUYC8JNPEYk5DJ9wtS2Dg=";
   };
 
   nativeBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/pyenphase/default.nix b/nixpkgs/pkgs/development/python-modules/pyenphase/default.nix
index 360db9124175..d18160d897d3 100644
--- a/nixpkgs/pkgs/development/python-modules/pyenphase/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/pyenphase/default.nix
@@ -18,7 +18,7 @@
 
 buildPythonPackage rec {
   pname = "pyenphase";
-  version = "1.12.0";
+  version = "1.13.1";
   format = "pyproject";
 
   disabled = pythonOlder "3.11";
@@ -27,7 +27,7 @@ buildPythonPackage rec {
     owner = "pyenphase";
     repo = "pyenphase";
     rev = "refs/tags/v${version}";
-    hash = "sha256-gqbRz0JAp8hjZpFUzlFzqq86UKgD0TLWSp1Z9rdrk3s=";
+    hash = "sha256-8wGGx7ERYm+lKvLW/NUcJeBTqEXPM0jJNOOlkj/UzYk=";
   };
 
   postPatch = ''
diff --git a/nixpkgs/pkgs/development/python-modules/pyliblo/default.nix b/nixpkgs/pkgs/development/python-modules/pyliblo/default.nix
index 52f59cc3fc8d..e56b1dfa3683 100644
--- a/nixpkgs/pkgs/development/python-modules/pyliblo/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/pyliblo/default.nix
@@ -10,19 +10,26 @@
 buildPythonPackage rec {
   pname = "pyliblo";
   version = "0.10.0";
-  disabled = isPyPy || pythonAtLeast "3.11";
+  disabled = isPyPy;
 
   src = fetchurl {
     url = "http://das.nasophon.de/download/${pname}-${version}.tar.gz";
     sha256 = "13vry6xhxm7adnbyj28w1kpwrh0kf7nw83cz1yq74wl21faz2rzw";
   };
 
+  patches = [
+    (fetchurl {
+      url = "https://git.alpinelinux.org/aports/plain/community/py3-pyliblo/py3.11.patch?id=a7e1eca5533657ddd7e37c43e67e8126e3447258";
+      hash = "sha256-4yCWNQaE/9FHGTVuvNEimBNuViWZ9aSJMcpTOP0fnM0=";
+    })
+  ];
+
   buildInputs = [ liblo cython ];
 
   meta = with lib; {
     homepage = "https://das.nasophon.de/pyliblo/";
     description = "Python wrapper for the liblo OSC library";
-    license = licenses.lgpl21;
+    license = licenses.lgpl21Only;
   };
 
 }
diff --git a/nixpkgs/pkgs/development/python-modules/pyrate-limiter/default.nix b/nixpkgs/pkgs/development/python-modules/pyrate-limiter/default.nix
index 0b3218e190a4..3aa0d42e2d50 100644
--- a/nixpkgs/pkgs/development/python-modules/pyrate-limiter/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/pyrate-limiter/default.nix
@@ -6,14 +6,14 @@
 
 buildPythonPackage rec {
   pname = "pyrate-limiter";
-  version = "3.1.0";
+  version = "2.10.0";
   format = "pyproject";
 
   src = fetchFromGitHub {
     owner = "vutran1710";
     repo = "PyrateLimiter";
-    rev = "refs/tags/v${version}";
-    hash = "sha256-WL+nNk68NaK36Lwalj23ugiSuB5acSLumLJGQaXE06A=";
+    rev = "v${version}";
+    hash = "sha256-CPusPeyTS+QyWiMHsU0ii9ZxPuizsqv0wQy3uicrDw0=";
   };
 
   nativeBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/pyscf/default.nix b/nixpkgs/pkgs/development/python-modules/pyscf/default.nix
index 29f795560d41..5089e19c2264 100644
--- a/nixpkgs/pkgs/development/python-modules/pyscf/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/pyscf/default.nix
@@ -16,13 +16,13 @@
 
 buildPythonPackage rec {
   pname = "pyscf";
-  version = "2.3.0";
+  version = "2.4.0";
 
   src = fetchFromGitHub {
     owner = "pyscf";
     repo = pname;
     rev = "v${version}";
-    hash = "sha256-x693NB0oc9X7SuDZlV3VKOmgnIgKA39O9yswDM0outk=";
+    hash = "sha256-+dZsXiLqqyRWr1eOEVSHZ1KMM760hrDaT07ylZUcGmo=";
   };
 
   # setup.py calls Cmake and passes the arguments in CMAKE_CONFIGURE_ARGS to cmake.
diff --git a/nixpkgs/pkgs/development/python-modules/pymyq/default.nix b/nixpkgs/pkgs/development/python-modules/python-myq/default.nix
index 91c691f843a3..f596828e6f9f 100644
--- a/nixpkgs/pkgs/development/python-modules/pymyq/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/python-myq/default.nix
@@ -9,7 +9,7 @@
 }:
 
 buildPythonPackage rec {
-  pname = "pymyq";
+  pname = "python-myq";
   version = "3.1.13";
   pyproject = true;
 
diff --git a/nixpkgs/pkgs/development/python-modules/readmdict/default.nix b/nixpkgs/pkgs/development/python-modules/readmdict/default.nix
new file mode 100644
index 000000000000..b7d61f8c8f57
--- /dev/null
+++ b/nixpkgs/pkgs/development/python-modules/readmdict/default.nix
@@ -0,0 +1,50 @@
+{ lib
+, buildPythonPackage
+, pythonOlder
+, fetchFromGitHub
+
+, poetry-core
+, python-lzo
+, tkinter
+
+, pytestCheckHook
+}:
+
+buildPythonPackage rec {
+  pname = "readmdict";
+  version = "0.1.1";
+  pyproject = true;
+
+  disabled = pythonOlder "3.6";
+
+  src = fetchFromGitHub {
+    owner = "ffreemt";
+    repo = "readmdict";
+    rev = "v${version}";
+    hash = "sha256-1/f+o2bVscT3EA8XQyS2hWjhimLRzfIBM6u2O7UqwcA=";
+  };
+
+  nativeBuildInputs = [
+    poetry-core
+  ];
+
+  propagatedBuildInputs = [
+    python-lzo
+    tkinter
+  ];
+
+  nativeCheckInputs = [
+    pytestCheckHook
+  ];
+
+  pythonImportsCheck = [
+    "readmdict"
+  ];
+
+  meta = with lib; {
+    description = "Read mdx/mdd files (repacking of readmdict from mdict-analysis)";
+    homepage = "https://github.com/ffreemt/readmdict";
+    license = licenses.mit;
+    maintainers = with maintainers; [ paveloom ];
+  };
+}
diff --git a/nixpkgs/pkgs/development/python-modules/sensor-state-data/default.nix b/nixpkgs/pkgs/development/python-modules/sensor-state-data/default.nix
index 7316256cd8aa..7802340cedef 100644
--- a/nixpkgs/pkgs/development/python-modules/sensor-state-data/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/sensor-state-data/default.nix
@@ -10,7 +10,7 @@
 
 buildPythonPackage rec {
   pname = "sensor-state-data";
-  version = "2.17.1";
+  version = "2.18.0";
   format = "pyproject";
 
   disabled = pythonOlder "3.9";
@@ -19,7 +19,7 @@ buildPythonPackage rec {
     owner = "Bluetooth-Devices";
     repo = pname;
     rev = "refs/tags/v${version}";
-    hash = "sha256-zfgkTBdE8UWwk+G3bLBThVjgU+m2QoPf1fzORyznEgs=";
+    hash = "sha256-wYYSS4lABCbIhmUU3z3Wh0+4zwpEzXl8Kk9gi6LBrbQ=";
   };
 
   nativeBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/streamlit/default.nix b/nixpkgs/pkgs/development/python-modules/streamlit/default.nix
index b764d9573451..b764d9573451 100755..100644
--- a/nixpkgs/pkgs/development/python-modules/streamlit/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/streamlit/default.nix
diff --git a/nixpkgs/pkgs/development/python-modules/textparser/default.nix b/nixpkgs/pkgs/development/python-modules/textparser/default.nix
new file mode 100644
index 000000000000..86c436ac21f9
--- /dev/null
+++ b/nixpkgs/pkgs/development/python-modules/textparser/default.nix
@@ -0,0 +1,39 @@
+{ lib
+, buildPythonPackage
+, fetchPypi
+, setuptools-scm
+, pytestCheckHook
+, pythonOlder
+}:
+
+buildPythonPackage rec {
+  pname = "textparser";
+  version = "0.24.0";
+  format = "setuptools";
+
+  disabled = pythonOlder "3.7";
+
+  src = fetchPypi {
+    inherit pname version;
+    hash = "sha256-VvcI51qp0AKtt22CO6bvFm1+zsHj5MpMHKED+BdWgzU=";
+  };
+
+  nativeBuildInputs = [
+    setuptools-scm
+  ];
+
+  nativeCheckInputs = [
+    pytestCheckHook
+  ];
+
+  pythonImportsCheck = [
+    "textparser"
+  ];
+
+  meta = with lib; {
+    homepage = "https://github.com/eerimoq/textparser";
+    description = "A text parser";
+    license = licenses.mit;
+    maintainers = with maintainers; [ gray-heron ];
+  };
+}
diff --git a/nixpkgs/pkgs/development/python-modules/toonapi/default.nix b/nixpkgs/pkgs/development/python-modules/toonapi/default.nix
index 8df8fa89a2ca..ac51cae1c805 100644
--- a/nixpkgs/pkgs/development/python-modules/toonapi/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/toonapi/default.nix
@@ -3,18 +3,22 @@
 , backoff
 , buildPythonPackage
 , fetchFromGitHub
+, pythonOlder
 , yarl
 }:
 
 buildPythonPackage rec {
   pname = "toonapi";
-  version = "0.2.1";
+  version = "0.3.0";
+  format = "setuptools";
+
+  disabled = pythonOlder "3.8";
 
   src = fetchFromGitHub {
     owner = "frenck";
     repo = "python-toonapi";
-    rev = "v${version}";
-    sha256 = "10jh6p0ww51cb9f8amd9jq3lmvby6n2k08qwcr2n8ijbbgyp0ibf";
+    rev = "refs/tags/v${version}";
+    hash = "sha256-RaN9ppqJbTik1/vNX0/YLoBawrqjyQWU6+FLTspIxug=";
   };
 
   propagatedBuildInputs = [
@@ -25,11 +29,15 @@ buildPythonPackage rec {
 
   # Project has no tests
   doCheck = false;
-  pythonImportsCheck = [ "toonapi" ];
+
+  pythonImportsCheck = [
+    "toonapi"
+  ];
 
   meta = with lib; {
     description = "Python client for the Quby ToonAPI";
     homepage = "https://github.com/frenck/python-toonapi";
+    changelog = "https://github.com/frenck/python-toonapi/releases/tag/v${version}";
     license = with licenses; [ mit ];
     maintainers = with maintainers; [ fab ];
   };
diff --git a/nixpkgs/pkgs/development/python-modules/trezor/default.nix b/nixpkgs/pkgs/development/python-modules/trezor/default.nix
index 109f48d1f71b..23af30faefba 100644
--- a/nixpkgs/pkgs/development/python-modules/trezor/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/trezor/default.nix
@@ -24,13 +24,13 @@
 
 buildPythonPackage rec {
   pname = "trezor";
-  version = "0.13.7";
+  version = "0.13.8";
 
   disabled = !isPy3k;
 
   src = fetchPypi {
     inherit pname version;
-    hash = "sha256-dodeWIYBfclPUbu0Efkn8QO9nj7L8HVNXkSjU4mBSeA=";
+    hash = "sha256-Y01O3fNWAyV8MhYY2FSMajWyc4Rle2XjsL261jWlfP8=";
   };
 
   nativeBuildInputs = [ installShellFiles ];
diff --git a/nixpkgs/pkgs/development/python-modules/twentemilieu/default.nix b/nixpkgs/pkgs/development/python-modules/twentemilieu/default.nix
index aa91f01686c7..e52f70753f32 100644
--- a/nixpkgs/pkgs/development/python-modules/twentemilieu/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/twentemilieu/default.nix
@@ -12,16 +12,16 @@
 
 buildPythonPackage rec {
   pname = "twentemilieu";
-  version = "1.0.0";
+  version = "2.0.0";
   format = "pyproject";
 
-  disabled = pythonOlder "3.10";
+  disabled = pythonOlder "3.11";
 
   src = fetchFromGitHub {
     owner = "frenck";
     repo = "python-twentemilieu";
-    rev = "v${version}";
-    hash = "sha256-MTAVa5gP5e8TIE/i1DjfmwKm1zDVC/WEcYKxZSV/+Ug=";
+    rev = "refs/tags/v${version}";
+    hash = "sha256-r0LZS8TXux1mzzXBTSu+x5sxUZOCzW7poKG3dQ2A6No=";
   };
 
   postPatch = ''
@@ -45,7 +45,9 @@ buildPythonPackage rec {
     pytestCheckHook
   ];
 
-  pythonImportsCheck = [ "twentemilieu" ];
+  pythonImportsCheck = [
+    "twentemilieu"
+  ];
 
   meta = with lib; {
     description = "Python client for Twente Milieu";
diff --git a/nixpkgs/pkgs/development/python-modules/vehicle/default.nix b/nixpkgs/pkgs/development/python-modules/vehicle/default.nix
index e1d4531719b4..a233b51773ac 100644
--- a/nixpkgs/pkgs/development/python-modules/vehicle/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/vehicle/default.nix
@@ -13,16 +13,16 @@
 
 buildPythonPackage rec {
   pname = "vehicle";
-  version = "1.0.1";
+  version = "2.0.0";
   format = "pyproject";
 
-  disabled = pythonOlder "3.10";
+  disabled = pythonOlder "3.11";
 
   src = fetchFromGitHub {
     owner = "frenck";
     repo = "python-vehicle";
     rev = "refs/tags/v${version}";
-    hash = "sha256-nN7efkN59FCCjCk3svYCTGGdvr2RSM5VektuUkHy3Vo=";
+    hash = "sha256-EbjrAfbqVY336RHBWq81KM+oHixen+38aUTnWZQ+nCs=";
   };
 
   nativeBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/velbus-aio/default.nix b/nixpkgs/pkgs/development/python-modules/velbus-aio/default.nix
index 1616de34bfea..0b06bf91548d 100644
--- a/nixpkgs/pkgs/development/python-modules/velbus-aio/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/velbus-aio/default.nix
@@ -10,7 +10,7 @@
 
 buildPythonPackage rec {
   pname = "velbus-aio";
-  version = "2023.10.0";
+  version = "2023.10.1";
   format = "setuptools";
 
   disabled = pythonOlder "3.7";
@@ -19,7 +19,7 @@ buildPythonPackage rec {
     owner = "Cereal2nd";
     repo = pname;
     rev = "refs/tags/${version}";
-    hash = "sha256-xVELkmucrw1QazSR2XN6ldmzdTya/rWsQd1mRsLTcbU=";
+    hash = "sha256-v2B+tDqvQTm+K+cvTRM8LnfaFp5CTsI8/B5clBDNE08=";
     fetchSubmodules = true;
   };
 
diff --git a/nixpkgs/pkgs/development/python-modules/wallbox/default.nix b/nixpkgs/pkgs/development/python-modules/wallbox/default.nix
index 4fe26418ef83..a53344a76fd1 100644
--- a/nixpkgs/pkgs/development/python-modules/wallbox/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/wallbox/default.nix
@@ -9,14 +9,14 @@
 
 buildPythonPackage rec {
   pname = "wallbox";
-  version = "0.4.14";
+  version = "0.5.1";
   format = "setuptools";
 
   disabled = pythonOlder "3.7";
 
   src = fetchPypi {
     inherit pname version;
-    hash = "sha256-HKlq5DPG3HD9i9LLTJdlzEFim+2hBdSfKl43BojhEf8=";
+    hash = "sha256-EDEB7/CkrfYSNcSh55Itrj6rThsNKeuj8lHLAY+Qml4=";
   };
 
   propagatedBuildInputs = [
diff --git a/nixpkgs/pkgs/development/python-modules/zstandard/default.nix b/nixpkgs/pkgs/development/python-modules/zstandard/default.nix
index 2bc20be4d4ed..2bc20be4d4ed 100755..100644
--- a/nixpkgs/pkgs/development/python-modules/zstandard/default.nix
+++ b/nixpkgs/pkgs/development/python-modules/zstandard/default.nix
diff --git a/nixpkgs/pkgs/development/tools/analysis/checkov/default.nix b/nixpkgs/pkgs/development/tools/analysis/checkov/default.nix
index f9655b201746..34bb4303724b 100644
--- a/nixpkgs/pkgs/development/tools/analysis/checkov/default.nix
+++ b/nixpkgs/pkgs/development/tools/analysis/checkov/default.nix
@@ -22,14 +22,14 @@ with py.pkgs;
 
 buildPythonApplication rec {
   pname = "checkov";
-  version = "2.5.14";
+  version = "2.5.15";
   format = "setuptools";
 
   src = fetchFromGitHub {
     owner = "bridgecrewio";
     repo = pname;
     rev = "refs/tags/${version}";
-    hash = "sha256-4F8cGcQJy8cbCE0wxM6B4qGjuc+SjeL7DMr6RdSkXBM=";
+    hash = "sha256-PVx66Ipvf+rISkuu9dw2ecFXXmuzITg2PogqRktFh5M=";
   };
 
   patches = [
diff --git a/nixpkgs/pkgs/development/tools/analysis/rizin/default.nix b/nixpkgs/pkgs/development/tools/analysis/rizin/default.nix
index e6b20bd5e159..d4bd1e84b112 100644
--- a/nixpkgs/pkgs/development/tools/analysis/rizin/default.nix
+++ b/nixpkgs/pkgs/development/tools/analysis/rizin/default.nix
@@ -25,11 +25,11 @@
 
 let rizin = stdenv.mkDerivation rec {
   pname = "rizin";
-  version = "0.6.2";
+  version = "0.6.3";
 
   src = fetchurl {
     url = "https://github.com/rizinorg/rizin/releases/download/v${version}/rizin-src-v${version}.tar.xz";
-    hash = "sha256-4poAo+IgBL3RAUbShrHM4OBhltQarkcpqvydeDIf+Gs=";
+    hash = "sha256-lfZMarnm2qnp+lY0OY649s206/LoFNouTLlp0x9FCcI=";
   };
 
   mesonFlags = [
diff --git a/nixpkgs/pkgs/development/tools/clj-kondo/default.nix b/nixpkgs/pkgs/development/tools/clj-kondo/default.nix
index 20f905a50ec9..dc78761cc256 100644
--- a/nixpkgs/pkgs/development/tools/clj-kondo/default.nix
+++ b/nixpkgs/pkgs/development/tools/clj-kondo/default.nix
@@ -2,11 +2,11 @@
 
 buildGraalvmNativeImage rec {
   pname = "clj-kondo";
-  version = "2023.09.07";
+  version = "2023.10.20";
 
   src = fetchurl {
     url = "https://github.com/clj-kondo/${pname}/releases/download/v${version}/${pname}-${version}-standalone.jar";
-    sha256 = "sha256-F7ePdITYKkGB6nsR3EFJ7zLDCUoT0g3i+AAjXzBd624=";
+    sha256 = "sha256-f9u/pk3CEEmiLgnS2biaUHpsMHjVEwZL2jyB/1PiZUY=";
   };
 
   extraNativeImageBuildArgs = [
diff --git a/nixpkgs/pkgs/development/tools/database/timescaledb-tune/default.nix b/nixpkgs/pkgs/development/tools/database/timescaledb-tune/default.nix
index 1fa12861d921..0236a5f51f3d 100644
--- a/nixpkgs/pkgs/development/tools/database/timescaledb-tune/default.nix
+++ b/nixpkgs/pkgs/development/tools/database/timescaledb-tune/default.nix
@@ -2,13 +2,13 @@
 
 buildGoModule rec {
   pname = "timescaledb-tune";
-  version = "0.14.3";
+  version = "0.14.4";
 
   src = fetchFromGitHub {
     owner = "timescale";
     repo = pname;
     rev = "v${version}";
-    sha256 = "sha256-MQi8A7eWOShP/VhxuX4Uhz1ueLtKvOi1x4E7aFXEsQo=";
+    sha256 = "sha256-lCbxGW6+/r5AnsSXvrE7jYL1ZywcTlb4RK3MurL1JWg=";
   };
 
   vendorHash = "sha256-yXWeINubvfZ2S+3gVFsrzeVO3XXIiZ14qfK+9Bj3SV4=";
diff --git a/nixpkgs/pkgs/development/tools/electron/binary/generic.nix b/nixpkgs/pkgs/development/tools/electron/binary/generic.nix
index cbd908098965..6e1493528e2b 100644
--- a/nixpkgs/pkgs/development/tools/electron/binary/generic.nix
+++ b/nixpkgs/pkgs/development/tools/electron/binary/generic.nix
@@ -40,7 +40,7 @@ let
       ++ optionals (versionAtLeast version "11.0.0") [ "aarch64-darwin" ]
       ++ optionals (versionOlder version "19.0.0") [ "i686-linux" ];
     sourceProvenance = with sourceTypes; [ binaryNativeCode ];
-    knownVulnerabilities = optional (versionOlder version "22.0.0" || versions.major version == "23") "Electron version ${version} is EOL";
+    knownVulnerabilities = optional (versionOlder version "25.0.0") "Electron version ${version} is EOL";
   };
 
   fetcher = vers: tag: hash: fetchurl {
diff --git a/nixpkgs/pkgs/development/tools/java/dex2jar/default.nix b/nixpkgs/pkgs/development/tools/java/dex2jar/default.nix
index 97fa2298b051..e0ce19dc8d2f 100644
--- a/nixpkgs/pkgs/development/tools/java/dex2jar/default.nix
+++ b/nixpkgs/pkgs/development/tools/java/dex2jar/default.nix
@@ -8,11 +8,11 @@
 
 stdenvNoCC.mkDerivation (finalAttrs: {
   pname = "dex2jar";
-  version  = "2.1";
+  version  = "2.4";
 
   src = fetchurl {
-    url = "https://github.com/pxb1988/dex2jar/releases/download/v${finalAttrs.version}/dex2jar-${finalAttrs.version}.zip";
-    hash = "sha256-epvfhD1D3k0elOwue29VglAXsMSn7jn/gmYOJJOkbwg=";
+    url = "https://github.com/pxb1988/dex2jar/releases/download/v${finalAttrs.version}/dex-tools-v${finalAttrs.version}.zip";
+    hash = "sha256-7nxF6zwdJHSmFF2NRH5lGnNqItlmS209O+WlqBfdojo=";
   };
 
   nativeBuildInputs = [ makeWrapper unzip ];
diff --git a/nixpkgs/pkgs/development/tools/misc/texlab/default.nix b/nixpkgs/pkgs/development/tools/misc/texlab/default.nix
index e33a288286ee..9bc36338ff2e 100644
--- a/nixpkgs/pkgs/development/tools/misc/texlab/default.nix
+++ b/nixpkgs/pkgs/development/tools/misc/texlab/default.nix
@@ -15,16 +15,16 @@ let
 in
 rustPlatform.buildRustPackage rec {
   pname = "texlab";
-  version = "5.10.0";
+  version = "5.10.1";
 
   src = fetchFromGitHub {
     owner = "latex-lsp";
     repo = "texlab";
     rev = "refs/tags/v${version}";
-    hash = "sha256-MTWaGgDIDo3CaRHyHWqliKsPdbU/TZPsyfF7SoHTnhk=";
+    hash = "sha256-ACdiFkV138jDIrRe+baYo+r9vCO4cyRyO2ck7OKakFY=";
   };
 
-  cargoHash = "sha256-8Vrp4d5luf91pKpUC4wWn4otsanqopCHwCjcnfTzyLk=";
+  cargoHash = "sha256-bEeQOOucXd4HNTR6SmidAfDkZ1tT7ORmUxrNx+3FNRw=";
 
   outputs = [ "out" ] ++ lib.optional (!isCross) "man";
 
@@ -41,7 +41,7 @@ rustPlatform.buildRustPackage rec {
   # generate the man page
   postInstall = lib.optionalString (!isCross) ''
     # TexLab builds man page separately in CI:
-    # https://github.com/latex-lsp/texlab/blob/v5.9.2/.github/workflows/publish.yml#L117-L121
+    # https://github.com/latex-lsp/texlab/blob/v5.10.1/.github/workflows/publish.yml#L117-L121
     help2man --no-info "$out/bin/texlab" > texlab.1
     installManPage texlab.1
   '';
diff --git a/nixpkgs/pkgs/development/tools/poetry2nix/poetry2nix/overrides/build-systems.json b/nixpkgs/pkgs/development/tools/poetry2nix/poetry2nix/overrides/build-systems.json
index 04174d1c4354..2e859c6ddbf5 100644
--- a/nixpkgs/pkgs/development/tools/poetry2nix/poetry2nix/overrides/build-systems.json
+++ b/nixpkgs/pkgs/development/tools/poetry2nix/poetry2nix/overrides/build-systems.json
@@ -2732,6 +2732,9 @@
   "certbot-dns-inwx": [
     "setuptools"
   ],
+  "certbot-dns-ovh": [
+    "setuptools"
+  ],
   "certbot-dns-rfc2136": [
     "setuptools"
   ],
diff --git a/nixpkgs/pkgs/development/tools/railway/default.nix b/nixpkgs/pkgs/development/tools/railway/default.nix
index 1d075250a415..688a475a1403 100644
--- a/nixpkgs/pkgs/development/tools/railway/default.nix
+++ b/nixpkgs/pkgs/development/tools/railway/default.nix
@@ -3,16 +3,16 @@
 
 rustPlatform.buildRustPackage rec {
   pname = "railway";
-  version = "3.4.0";
+  version = "3.5.0";
 
   src = fetchFromGitHub {
     owner = "railwayapp";
     repo = "cli";
     rev = "v${version}";
-    hash = "sha256-pydnIUqUBMLHonEGcvB+K+48QQYQuFfZxbAETJjU+3o=";
+    hash = "sha256-I32DC0hzVM/LCSqS878sZd+UYZ0NfBuzBgd9Aed/Sq0=";
   };
 
-  cargoHash = "sha256-VgLQfUk1xeAwr9KUo1Vz4Ndw0FAnYGw3af0v3ueNPuA=";
+  cargoHash = "sha256-CYy0YEWK9sHAr0yFIH9yzxPnzG6x/EcE8ZLkueYgSiE=";
 
   nativeBuildInputs = [ pkg-config ];
 
diff --git a/nixpkgs/pkgs/development/tools/rust/cargo-codspeed/default.nix b/nixpkgs/pkgs/development/tools/rust/cargo-codspeed/default.nix
index f2a9376e2fa3..d27f17bfac2f 100644
--- a/nixpkgs/pkgs/development/tools/rust/cargo-codspeed/default.nix
+++ b/nixpkgs/pkgs/development/tools/rust/cargo-codspeed/default.nix
@@ -12,16 +12,16 @@
 
 rustPlatform.buildRustPackage rec {
   pname = "cargo-codspeed";
-  version = "2.2.0";
+  version = "2.3.0";
 
   src = fetchFromGitHub {
     owner = "CodSpeedHQ";
     repo = "codspeed-rust";
     rev = "v${version}";
-    hash = "sha256-AGbo38weLBPxkaXgJpi+FXGuhPh7nyZcJOhw6BCDYOc=";
+    hash = "sha256-oI6IfKvX+Zn3tYPXQVxHRQymVz4bBvXfg3mcrjClbY4=";
   };
 
-  cargoHash = "sha256-NR+Z5oMaReEOZrLk7d/pB1F37k8tE7FXh4HdVnh+YFc=";
+  cargoHash = "sha256-ZZhYmyWoqZ8SbRpXCA5XsKCdeqAKAcE1NdNlrHhBiYI=";
 
   nativeBuildInputs = [
     curl
diff --git a/nixpkgs/pkgs/development/web/minify/default.nix b/nixpkgs/pkgs/development/web/minify/default.nix
index 1c832bb456db..86ef8a4759f2 100644
--- a/nixpkgs/pkgs/development/web/minify/default.nix
+++ b/nixpkgs/pkgs/development/web/minify/default.nix
@@ -9,16 +9,16 @@
 
 buildGoModule rec {
   pname = "minify";
-  version = "2.12.9";
+  version = "2.19.10";
 
   src = fetchFromGitHub {
     owner = "tdewolff";
     repo = pname;
     rev = "v${version}";
-    hash = "sha256-+NBYn+gEsoclROnq2msNB4knviGn/XA9vNAuB0JZNek=";
+    hash = "sha256-/OfNHhWbRZI7nRhBnjXfxL4Gf011ydlwEMDadCptFJY=";
   };
 
-  vendorHash = "sha256-/Pw7fHVXWsovxfyzkWfb6UiRDBmiua82667N4Scl5+A=";
+  vendorHash = "sha256-ZtQbhhdt9mGRbTpgm6O4wnSPoKF9bAEswppmK+Urqhs=";
 
   nativeBuildInputs = [ installShellFiles ];
 
diff --git a/nixpkgs/pkgs/games/openra/build-engine.nix b/nixpkgs/pkgs/games/openra/build-engine.nix
index 664a4c0735b3..10e8b4939215 100644
--- a/nixpkgs/pkgs/games/openra/build-engine.nix
+++ b/nixpkgs/pkgs/games/openra/build-engine.nix
@@ -36,7 +36,7 @@ buildDotnetModule rec {
   dontDotnetFixup = true;
 
   preBuild = ''
-    make VERSION=${version} version
+    make VERSION=${engine.build}-${version} version
   '';
 
   postInstall = ''
diff --git a/nixpkgs/pkgs/games/starsector/default.nix b/nixpkgs/pkgs/games/starsector/default.nix
index 3951f36f83bf..e1bc4a8dbbcf 100644
--- a/nixpkgs/pkgs/games/starsector/default.nix
+++ b/nixpkgs/pkgs/games/starsector/default.nix
@@ -13,11 +13,11 @@
 
 stdenv.mkDerivation rec {
   pname = "starsector";
-  version = "0.96a-RC8";
+  version = "0.96a-RC10";
 
   src = fetchzip {
-    url = "https://s3.amazonaws.com/fractalsoftworks/starsector/starsector_linux-${version}.zip";
-    sha256 = "sha256-RDXqFqiWpBG3kasofzbOl7Zp0a9LiMpJKsHcFaJtm2Y=";
+    url = "https://f005.backblazeb2.com/file/fractalsoftworks/release/starsector_linux-${version}.zip";
+    sha256 = "sha256-RBSnms+QlKgTOhm3t2hDfv7OcMrQCk1rfkz9GaM74WM=";
   };
 
   nativeBuildInputs = [ copyDesktopItems makeWrapper ];
@@ -82,7 +82,7 @@ stdenv.mkDerivation rec {
     #!/usr/bin/env nix-shell
     #!nix-shell -i bash -p curl gnugrep common-updater-scripts
     set -eou pipefail;
-    version=$(curl -s https://fractalsoftworks.com/preorder/ | grep -oP "https://s3.amazonaws.com/fractalsoftworks/starsector/starsector_linux-\K.*?(?=\.zip)" | head -1)
+    version=$(curl -s https://fractalsoftworks.com/preorder/ | grep -oP "https://f005.backblazeb2.com/file/fractalsoftworks/release/starsector_linux-\K.*?(?=\.zip)" | head -1)
     update-source-version ${pname} "$version" --file=./pkgs/games/starsector/default.nix
   '';
 }
diff --git a/nixpkgs/pkgs/games/steam/fhsenv.nix b/nixpkgs/pkgs/games/steam/fhsenv.nix
index a6734b640638..78c669614c07 100644
--- a/nixpkgs/pkgs/games/steam/fhsenv.nix
+++ b/nixpkgs/pkgs/games/steam/fhsenv.nix
@@ -3,6 +3,7 @@
 , extraPkgs ? pkgs: [ ] # extra packages to add to targetPkgs
 , extraLibraries ? pkgs: [ ] # extra packages to add to multiPkgs
 , extraProfile ? "" # string to append to profile
+, extraBwrapArgs ? [ ] # extra arguments to pass to bubblewrap
 , extraArgs ? "" # arguments to always pass to steam
 , extraEnv ? { } # Environment variables to pass to Steam
 , withGameSpecificLibraries ? true # include game specific libraries
@@ -277,6 +278,8 @@ in buildFHSEnv rec {
     exec steam ${extraArgs} "$@"
   '';
 
+  inherit extraBwrapArgs;
+
   meta =
     if steam != null
     then
@@ -287,21 +290,11 @@ in buildFHSEnv rec {
       description = "Steam dependencies (dummy package, do not use)";
     };
 
-  # allows for some gui applications to share IPC
-  # this fixes certain issues where they don't render correctly
-  unshareIpc = false;
-
-  # Some applications such as Natron need access to MIT-SHM or other
-  # shared memory mechanisms. Unsharing the pid namespace
-  # breaks the ability for application to reference shared memory.
-  unsharePid = false;
-
   passthru.run = buildFHSEnv {
     name = "steam-run";
 
     targetPkgs = commonTargetPkgs;
-    inherit multiArch multiPkgs profile extraInstallCommands;
-    inherit unshareIpc unsharePid;
+    inherit multiArch multiPkgs profile extraInstallCommands extraBwrapArgs;
 
     runScript = writeShellScript "steam-run" ''
       run="$1"
diff --git a/nixpkgs/pkgs/misc/uq/default.nix b/nixpkgs/pkgs/misc/uq/default.nix
index 81c09685be8b..81c09685be8b 100755..100644
--- a/nixpkgs/pkgs/misc/uq/default.nix
+++ b/nixpkgs/pkgs/misc/uq/default.nix
diff --git a/nixpkgs/pkgs/os-specific/linux/kernel/zen-kernels.nix b/nixpkgs/pkgs/os-specific/linux/kernel/zen-kernels.nix
index 716a45820ca5..f978cb429df5 100644
--- a/nixpkgs/pkgs/os-specific/linux/kernel/zen-kernels.nix
+++ b/nixpkgs/pkgs/os-specific/linux/kernel/zen-kernels.nix
@@ -4,16 +4,16 @@ let
   # comments with variant added for update script
   # ./update-zen.py zen
   zenVariant = {
-    version = "6.5.7"; #zen
-    suffix = "zen2"; #zen
-    sha256 = "0qy3xn7kr16crm7iw1zhm3kpgxpmn66xc4g1yalvghwn6si0n81l"; #zen
+    version = "6.5.8"; #zen
+    suffix = "zen1"; #zen
+    sha256 = "0pg5q5alsxrbbf8hzbcgmwsyirs86715qijdzaldyw9sf74h4z1l"; #zen
     isLqx = false;
   };
   # ./update-zen.py lqx
   lqxVariant = {
-    version = "6.5.7"; #lqx
+    version = "6.5.8"; #lqx
     suffix = "lqx1"; #lqx
-    sha256 = "1c4093xhfnzx6h8frqcigdlikgy1n0vv34ajs0237v3w7psw99d7"; #lqx
+    sha256 = "1f10p7mriwjrgmdfz10vs48xiipdk9ljj884fsj63r5n1g7pz4bf"; #lqx
     isLqx = true;
   };
   zenKernelsFor = { version, suffix, sha256, isLqx }: buildLinux (args // {
diff --git a/nixpkgs/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix b/nixpkgs/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix
index a0663c9dbe4f..715d261eea4f 100644
--- a/nixpkgs/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix
+++ b/nixpkgs/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix
@@ -1,4 +1,4 @@
-{
+{ hostPlatform
 }:
 
 rec {
@@ -65,7 +65,7 @@ rec {
   */
   minimal-bootstrap-sources = derivation {
     inherit name;
-    system = builtins.currentSystem;
+    system = hostPlatform.system;
     outputHashMode = "recursive";
     inherit outputHashAlgo outputHash;
 
diff --git a/nixpkgs/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix b/nixpkgs/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix
index 381902cd2c12..6cc7cddb82af 100644
--- a/nixpkgs/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix
+++ b/nixpkgs/pkgs/os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix
@@ -12,12 +12,13 @@
 #
 
 { lib
+, hostPlatform
 , fetchFromGitHub
 , fetchpatch
 }:
 
 let
-  expected = import ./bootstrap-sources.nix { };
+  expected = import ./bootstrap-sources.nix { inherit hostPlatform; };
 in
 
 fetchFromGitHub {
diff --git a/nixpkgs/pkgs/os-specific/linux/oci-seccomp-bpf-hook/default.nix b/nixpkgs/pkgs/os-specific/linux/oci-seccomp-bpf-hook/default.nix
index 40ef0796dfa1..61a27bd51f02 100644
--- a/nixpkgs/pkgs/os-specific/linux/oci-seccomp-bpf-hook/default.nix
+++ b/nixpkgs/pkgs/os-specific/linux/oci-seccomp-bpf-hook/default.nix
@@ -10,12 +10,12 @@
 
 buildGoModule rec {
   pname = "oci-seccomp-bpf-hook";
-  version = "1.2.9";
+  version = "1.2.10";
   src = fetchFromGitHub {
     owner = "containers";
     repo = "oci-seccomp-bpf-hook";
     rev = "v${version}";
-    sha256 = "sha256-KPO9xqLgPML6smoO7P50yP81b4iCvRFIR74ciUiva7o=";
+    sha256 = "sha256-bWlm+JYNf7+faKSQfW5fhxoH/D2I8ujjakswH+1r49o=";
   };
   vendorHash = null;
 
diff --git a/nixpkgs/pkgs/servers/home-assistant/component-packages.nix b/nixpkgs/pkgs/servers/home-assistant/component-packages.nix
index 128f20777fe2..7f9efafdfe9a 100644
--- a/nixpkgs/pkgs/servers/home-assistant/component-packages.nix
+++ b/nixpkgs/pkgs/servers/home-assistant/component-packages.nix
@@ -2,7 +2,7 @@
 # Do not edit!
 
 {
-  version = "2023.10.3";
+  version = "2023.10.4";
   components = {
     "3_day_blinds" = ps: with ps; [
     ];
@@ -2771,7 +2771,8 @@
       sqlalchemy
     ];
     "myq" = ps: with ps; [
-    ]; # missing inputs: python-myq
+      python-myq
+    ];
     "mysensors" = ps: with ps; [
       aiohttp-cors
       janus
@@ -5405,6 +5406,7 @@
     "mullvad"
     "mutesync"
     "my"
+    "myq"
     "mysensors"
     "mystrom"
     "mythicbeastsdns"
diff --git a/nixpkgs/pkgs/servers/home-assistant/default.nix b/nixpkgs/pkgs/servers/home-assistant/default.nix
index 8dcbe79ee81a..39c2c075eadd 100644
--- a/nixpkgs/pkgs/servers/home-assistant/default.nix
+++ b/nixpkgs/pkgs/servers/home-assistant/default.nix
@@ -427,7 +427,7 @@ let
   extraBuildInputs = extraPackages python.pkgs;
 
   # Don't forget to run parse-requirements.py after updating
-  hassVersion = "2023.10.3";
+  hassVersion = "2023.10.4";
 
 in python.pkgs.buildPythonApplication rec {
   pname = "homeassistant";
@@ -443,7 +443,7 @@ in python.pkgs.buildPythonApplication rec {
   # Primary source is the pypi sdist, because it contains translations
   src = fetchPypi {
     inherit pname version;
-    hash = "sha256-7Eg6Ik8eiPPUTXyRedQLixaCnHDg9Dmikmhcq55+458=";
+    hash = "sha256-HG8Uyk52Bj9CpQ+dn+dbsXVBKakXDlRktG4KSkVVVmE=";
   };
 
   # Secondary source is git for tests
@@ -451,7 +451,7 @@ in python.pkgs.buildPythonApplication rec {
     owner = "home-assistant";
     repo = "core";
     rev = "refs/tags/${version}";
-    hash = "sha256-4J1BBC6PvfbN4fKD+zUpW19sMvoKALilitNJlwB0ZTk=";
+    hash = "sha256-m3MjJHFq9S0dogFijIlpryqGQoHpLqkqgkWLuIxLHa8=";
   };
 
   nativeBuildInputs = with python.pkgs; [
diff --git a/nixpkgs/pkgs/servers/home-assistant/stubs.nix b/nixpkgs/pkgs/servers/home-assistant/stubs.nix
index adc7089741e9..a0146829bf2c 100644
--- a/nixpkgs/pkgs/servers/home-assistant/stubs.nix
+++ b/nixpkgs/pkgs/servers/home-assistant/stubs.nix
@@ -8,7 +8,7 @@
 
 buildPythonPackage rec {
   pname = "homeassistant-stubs";
-  version = "2023.10.1";
+  version = "2023.10.4";
   format = "pyproject";
 
   disabled = python.version != home-assistant.python.version;
@@ -17,7 +17,7 @@ buildPythonPackage rec {
     owner = "KapJI";
     repo = "homeassistant-stubs";
     rev = "refs/tags/${version}";
-    hash = "sha256-4TPjYBTyrJtnYVZ+F/Bxf6m0lZn6fQR3ai0+CDTqwVc=";
+    hash = "sha256-iehGVXom5Wjw7A0PC4wfzed+w1h1/g9SKIuCuVRtIAs=";
   };
 
   nativeBuildInputs = [
diff --git a/nixpkgs/pkgs/servers/http/apache-httpd/2.4.nix b/nixpkgs/pkgs/servers/http/apache-httpd/2.4.nix
index 98a00afc519d..c6e7ad1f5661 100644
--- a/nixpkgs/pkgs/servers/http/apache-httpd/2.4.nix
+++ b/nixpkgs/pkgs/servers/http/apache-httpd/2.4.nix
@@ -13,11 +13,11 @@
 
 stdenv.mkDerivation rec {
   pname = "apache-httpd";
-  version = "2.4.57";
+  version = "2.4.58";
 
   src = fetchurl {
     url = "mirror://apache/httpd/httpd-${version}.tar.bz2";
-    sha256 = "sha256-28y4Su6V4JXt+7geXrkmzNJOatpV3Ng8rssmLlz5TSo=";
+    sha256 = "sha256-+hbXKgeCEKVMR91b7y+Lm4oB2UkJpRRTlWs+xkQupMU=";
   };
 
   # FIXME: -dev depends on -doc
diff --git a/nixpkgs/pkgs/servers/http/lighttpd/default.nix b/nixpkgs/pkgs/servers/http/lighttpd/default.nix
index b0bb720c21cd..0c83c2e750a0 100644
--- a/nixpkgs/pkgs/servers/http/lighttpd/default.nix
+++ b/nixpkgs/pkgs/servers/http/lighttpd/default.nix
@@ -15,26 +15,15 @@
 
 stdenv.mkDerivation rec {
   pname = "lighttpd";
-  version = "1.4.71";
+  version = "1.4.72";
 
   src = fetchurl {
     url = "https://download.lighttpd.net/lighttpd/releases-${lib.versions.majorMinor version}.x/${pname}-${version}.tar.xz";
-    sha256 = "sha256-uLaRXaIDlv3DVN8zJNXkQBabLl6nhZ46d1IThBMlr6w=";
+    sha256 = "sha256-98reTWm3VKB0jAFGPDPNi0VsqcwDuwnoWnG8vNVOVew=";
   };
 
-  patches = [
-    # disable tests for des/md5, which we don't support any more
-    ./disable-legacy-crypt-tests.patch
-  ];
-
   postPatch = ''
     patchShebangs tests
-    # Linux sandbox has an empty hostname and not /etc/hosts, which fails some tests
-    sed -ire '/[$]self->{HOSTNAME} *=/i     if(length($name)==0) { $name = "127.0.0.1" }' tests/LightyTest.pm
-    # it's difficult to prevent this test from trying to use /var/tmp (which
-    # the sandbox doesn't have) so until libredirect has support for mkstemp
-    # calls it's easiest to disable it
-    sed -i '/test_mod_ssi/d' src/t/test_mod.c
   '';
 
   depsBuildBuild = [ buildPackages.stdenv.cc ];
diff --git a/nixpkgs/pkgs/servers/http/lighttpd/disable-legacy-crypt-tests.patch b/nixpkgs/pkgs/servers/http/lighttpd/disable-legacy-crypt-tests.patch
deleted file mode 100644
index 4a411c0b98ae..000000000000
--- a/nixpkgs/pkgs/servers/http/lighttpd/disable-legacy-crypt-tests.patch
+++ /dev/null
@@ -1,35 +0,0 @@
-diff -uNr lighttpd-1.4.71.orig/tests/mod-fastcgi.t lighttpd-1.4.71.new/tests/mod-fastcgi.t
---- lighttpd-1.4.71.orig/tests/mod-fastcgi.t	2023-05-27 21:56:16.000000000 +0200
-+++ lighttpd-1.4.71.new/tests/mod-fastcgi.t	2023-06-01 07:01:59.789873512 +0200
-@@ -79,7 +79,7 @@
- 	ok($tf->handle_http($t) == 0, 'FastCGI + bin-copy-environment');
- 
- SKIP: {
--	skip "no crypt-des under openbsd or MS Visual Studio", 2 if $^O eq 'openbsd' || $tf->{'win32native'};
-+	skip "no crypt-des", 2;
- 
- 	$t->{REQUEST}  = ( <<EOF
- GET /get-server-env.php?env=REMOTE_USER HTTP/1.0
-diff -uNr lighttpd-1.4.71.orig/tests/request.t lighttpd-1.4.71.new/tests/request.t
---- lighttpd-1.4.71.orig/tests/request.t	2023-05-27 21:56:16.000000000 +0200
-+++ lighttpd-1.4.71.new/tests/request.t	2023-06-01 07:02:39.855940048 +0200
-@@ -1106,7 +1106,7 @@
- ok($tf->handle_http($t) == 0, 'Basic-Auth: Valid Auth-token - plain');
- 
- SKIP: {
--	skip "no crypt-des under openbsd or MS Visual Studio", 2 if $^O eq 'openbsd' || $tf->{'win32native'};
-+	skip "no crypt-des", 2;
- $t->{REQUEST}  = ( <<EOF
- GET /server-config HTTP/1.0
- Host: auth-htpasswd.example.org
-@@ -1163,9 +1163,7 @@
- ok($tf->handle_http($t) == 0, 'Basic-Auth: Valid Auth-token - htpasswd (apr-md5, wrong password)');
- 
- SKIP: {
--	skip "no crypt-md5 under cygwin", 1 if $^O eq 'cygwin';
--	skip "no crypt-md5 under darwin", 1 if $^O eq 'darwin';
--	skip "no crypt-md5 under openbsd",1 if $^O eq 'openbsd';
-+	skip "no crypt-md5", 1;
- $t->{REQUEST}  = ( <<EOF
- GET /server-config HTTP/1.0
- Host: auth-htpasswd.example.org
diff --git a/nixpkgs/pkgs/servers/http/nginx/generic.nix b/nixpkgs/pkgs/servers/http/nginx/generic.nix
index 1f175c03d8a8..8f90adab101b 100644
--- a/nixpkgs/pkgs/servers/http/nginx/generic.nix
+++ b/nixpkgs/pkgs/servers/http/nginx/generic.nix
@@ -186,7 +186,7 @@ stdenv.mkDerivation {
   passthru = {
     inherit modules;
     tests = {
-      inherit (nixosTests) nginx nginx-auth nginx-etag nginx-globalredirect nginx-http3 nginx-proxyprotocol nginx-pubhtml nginx-sandbox nginx-sso nginx-status-page;
+      inherit (nixosTests) nginx nginx-auth nginx-etag nginx-globalredirect nginx-http3 nginx-proxyprotocol nginx-pubhtml nginx-sandbox nginx-sso nginx-status-page nginx-unix-socket;
       variants = lib.recurseIntoAttrs nixosTests.nginx-variants;
       acme-integration = nixosTests.acme;
     } // passthru.tests;
diff --git a/nixpkgs/pkgs/servers/http/tomcat/tomcat-native.nix b/nixpkgs/pkgs/servers/http/tomcat/tomcat-native.nix
index 5f9ea8a1665d..bd05943ac71f 100644
--- a/nixpkgs/pkgs/servers/http/tomcat/tomcat-native.nix
+++ b/nixpkgs/pkgs/servers/http/tomcat/tomcat-native.nix
@@ -2,11 +2,11 @@
 
 stdenv.mkDerivation rec {
   pname = "tomcat-native";
-  version = "2.0.5";
+  version = "2.0.6";
 
   src = fetchurl {
     url = "mirror://apache/tomcat/tomcat-connectors/native/${version}/source/${pname}-${version}-src.tar.gz";
-    hash = "sha256-lY0fEhZRwQxhVW133J0NQfO1OYiiGVRC3krG9MuHg4g=";
+    hash = "sha256-vmF8V26SO2B50LdSBtcG2ifdBDzr9Qv7leOpwKodGjU=";
   };
 
   sourceRoot = "${pname}-${version}-src/native";
diff --git a/nixpkgs/pkgs/servers/monitoring/librenms/default.nix b/nixpkgs/pkgs/servers/monitoring/librenms/default.nix
index 79b550e28146..0fab1b334890 100644
--- a/nixpkgs/pkgs/servers/monitoring/librenms/default.nix
+++ b/nixpkgs/pkgs/servers/monitoring/librenms/default.nix
@@ -23,7 +23,6 @@
 let
   phpPackage = php82.withExtensions ({ enabled, all }: enabled ++ [ all.memcached ]);
 in phpPackage.buildComposerProject rec {
-  name = pname + "-" + version;
   pname = "librenms";
   version = "23.9.1";
 
diff --git a/nixpkgs/pkgs/servers/samba/4.x.nix b/nixpkgs/pkgs/servers/samba/4.x.nix
index ed8744ef3c62..4665402361d5 100644
--- a/nixpkgs/pkgs/servers/samba/4.x.nix
+++ b/nixpkgs/pkgs/servers/samba/4.x.nix
@@ -51,11 +51,11 @@ with lib;
 
 stdenv.mkDerivation rec {
   pname = "samba";
-  version = "4.18.6";
+  version = "4.19.1";
 
   src = fetchurl {
     url = "mirror://samba/pub/samba/stable/${pname}-${version}.tar.gz";
-    hash = "sha256-KEyKmUzpich81oCMOQ/LnQDDayGg3BqKdUdLZ8nnFec=";
+    hash = "sha256-zjt/DRi/kapf1kbouzhaOzU3W3A8blEjsCuFoavIGHk=";
   };
 
   outputs = [ "out" "dev" "man" ];
diff --git a/nixpkgs/pkgs/servers/teleport/11/default.nix b/nixpkgs/pkgs/servers/teleport/11/default.nix
index 59d788872b88..3a935b630e72 100644
--- a/nixpkgs/pkgs/servers/teleport/11/default.nix
+++ b/nixpkgs/pkgs/servers/teleport/11/default.nix
@@ -1,7 +1,7 @@
 { callPackage, ... }@args:
 callPackage ../generic.nix ({
-  version = "11.3.25";
-  hash = "sha256-KIbRn90BUJp8Uc8GMHuIMMSn5tJQbxzE0ntngx1ELaE=";
+  version = "11.3.27";
+  hash = "sha256-A3EeFQsDOaggfb5S+eyRCe/vm054MabfRrcHPxhO0So=";
   vendorHash = "sha256-hjMv/H4dlinlv3ku7i1km2/b+6uCdbznHtVOMIjDlUc=";
   yarnHash = "sha256-hip0WQVZpx2qfVDmEy4nk4UFYEjX1Xhj8HsIIQ8PF1Y=";
   cargoLock = {
diff --git a/nixpkgs/pkgs/servers/teleport/12/Cargo.lock b/nixpkgs/pkgs/servers/teleport/12/Cargo.lock
index 895145e3927f..c150d003f3ac 100644
--- a/nixpkgs/pkgs/servers/teleport/12/Cargo.lock
+++ b/nixpkgs/pkgs/servers/teleport/12/Cargo.lock
@@ -1734,9 +1734,9 @@ dependencies = [
 
 [[package]]
 name = "webpki"
-version = "0.22.0"
+version = "0.22.2"
 source = "registry+https://github.com/rust-lang/crates.io-index"
-checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd"
+checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f"
 dependencies = [
  "ring",
  "untrusted 0.7.1",
diff --git a/nixpkgs/pkgs/servers/teleport/12/default.nix b/nixpkgs/pkgs/servers/teleport/12/default.nix
index e53fdcce494a..ee166f5d4721 100644
--- a/nixpkgs/pkgs/servers/teleport/12/default.nix
+++ b/nixpkgs/pkgs/servers/teleport/12/default.nix
@@ -1,9 +1,9 @@
 { callPackage, ... }@args:
 callPackage ../generic.nix ({
-  version = "12.4.20";
-  hash = "sha256-Qz+JOS4YPj2865Fkj7eVJMdilHMOGbTD179bQ5wHY7A=";
-  vendorHash = "sha256-cS8ylLujgp9Is+D2JjoK4yGgWRCVRyRw3NPQAAuE2vY=";
-  yarnHash = "sha256-tOdT7X8jM+tl1GZ7lBN2aW8KRiVW/zWK9fZIU7CSHVE=";
+  version = "12.4.22";
+  hash = "sha256-UEiS+GiderYTU34GHsQr4G8XrasV5ewmPcdrec4v5B4=";
+  vendorHash = "sha256-etutgK/5u+e86kx7ha3x+di9np7Tcr7hpGUMKZxJNT4=";
+  yarnHash = "sha256-MBTElkMH5rb33l+AYWH+zguSLQf+ntXpOkHZpjLAx/Q=";
   cargoLock = {
     lockFile = ./Cargo.lock;
     outputHashes = {
diff --git a/nixpkgs/pkgs/servers/teleport/13/Cargo.lock b/nixpkgs/pkgs/servers/teleport/13/Cargo.lock
index b82c0b0e435f..d22467c3e7dc 100644
--- a/nixpkgs/pkgs/servers/teleport/13/Cargo.lock
+++ b/nixpkgs/pkgs/servers/teleport/13/Cargo.lock
@@ -1786,9 +1786,9 @@ dependencies = [
 
 [[package]]
 name = "webpki"
-version = "0.22.0"
+version = "0.22.2"
 source = "registry+https://github.com/rust-lang/crates.io-index"
-checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd"
+checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f"
 dependencies = [
  "ring",
  "untrusted 0.7.1",
diff --git a/nixpkgs/pkgs/servers/teleport/13/default.nix b/nixpkgs/pkgs/servers/teleport/13/default.nix
index 58d682f52ac2..65cbed70d9cc 100644
--- a/nixpkgs/pkgs/servers/teleport/13/default.nix
+++ b/nixpkgs/pkgs/servers/teleport/13/default.nix
@@ -1,9 +1,9 @@
 { callPackage, ... }@args:
 callPackage ../generic.nix ({
-  version = "13.4.1";
-  hash = "sha256-wgSaek4eq5Jx9SZFenvdRSU1wEtfJHzTz9GdczzUU2w=";
-  vendorHash = "sha256-DesT18nV/SxOsKCC+Nt0hgtH7CRtRL0B5FQhE1J148I=";
-  yarnHash = "sha256-iyMcP9L6dwBhN8JL9eSVEzsXI2EOjfyxjF9Dm4Gs04s=";
+  version = "13.4.3";
+  hash = "sha256-x8G94jKycK3nYwqDA5RPc63GHIk9y4pHfSwSBqGBINk=";
+  vendorHash = "sha256-Pb3eO9zqLgTD7otM7yGRWicQjvpIXg7xKV8Oc4yh8PA=";
+  yarnHash = "sha256-GnoiLqzqGV0UZm5zePCDBUUX63NTIIo1dcxtiWQDPqc=";
   cargoLock = {
     lockFile = ./Cargo.lock;
     outputHashes = {
diff --git a/nixpkgs/pkgs/servers/teleport/14/Cargo.lock b/nixpkgs/pkgs/servers/teleport/14/Cargo.lock
index 8b18ac74ae70..c9b50a388b0b 100644
--- a/nixpkgs/pkgs/servers/teleport/14/Cargo.lock
+++ b/nixpkgs/pkgs/servers/teleport/14/Cargo.lock
@@ -1789,9 +1789,9 @@ dependencies = [
 
 [[package]]
 name = "webpki"
-version = "0.22.0"
+version = "0.22.2"
 source = "registry+https://github.com/rust-lang/crates.io-index"
-checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd"
+checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f"
 dependencies = [
  "ring",
  "untrusted 0.7.1",
diff --git a/nixpkgs/pkgs/servers/teleport/14/default.nix b/nixpkgs/pkgs/servers/teleport/14/default.nix
index 15a594ef13e6..71036da070ef 100644
--- a/nixpkgs/pkgs/servers/teleport/14/default.nix
+++ b/nixpkgs/pkgs/servers/teleport/14/default.nix
@@ -1,9 +1,9 @@
 { callPackage, ... }@args:
 callPackage ../generic.nix ({
-  version = "14.0.1";
-  hash = "sha256-esQwk2PFnk3/REzLr3ExtzEcUs2q4Tn/2KpfFWAx5uU=";
-  vendorHash = "sha256-lzwrkW0dHxCHBSJjzNhXgq3Av8Zj8xEn3kfTRtT/q04=";
-  yarnHash = "sha256-Y2dVxRyKPLD2xjwr0QqrKHf/4gnMCErmDzievu5zTGg=";
+  version = "14.0.3";
+  hash = "sha256-X+vekYmuTE7n22SH/z2GWO3wnBsIef1GEjR7WOJpjc8=";
+  vendorHash = "sha256-+R6f2HrlN/RLec83YutccDFJW6gq6HXbxoJVtxMgdp8=";
+  yarnHash = "sha256-udM4DNaTGiMkqfkllJjmT+Nk6PNbGUzT34ixQOhmScw=";
   cargoLock = {
     lockFile = ./Cargo.lock;
     outputHashes = {
diff --git a/nixpkgs/pkgs/servers/unifi-video/default.nix b/nixpkgs/pkgs/servers/unifi-video/default.nix
index 45a9b5c6fb61..45a9b5c6fb61 100755..100644
--- a/nixpkgs/pkgs/servers/unifi-video/default.nix
+++ b/nixpkgs/pkgs/servers/unifi-video/default.nix
diff --git a/nixpkgs/pkgs/stdenv/linux/default.nix b/nixpkgs/pkgs/stdenv/linux/default.nix
index 5c03312cc75f..35cdb6311df3 100644
--- a/nixpkgs/pkgs/stdenv/linux/default.nix
+++ b/nixpkgs/pkgs/stdenv/linux/default.nix
@@ -68,7 +68,7 @@
       mipsel-linux = import ./bootstrap-files/mipsel-unknown-linux-gnu.nix;
       mips64el-linux = import
        (if localSystem.isMips64n32
-        then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix.nix
+        then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix
         else ./bootstrap-files/mips64el-unknown-linux-gnuabi64.nix);
       powerpc64le-linux = import ./bootstrap-files/powerpc64le-unknown-linux-gnu.nix;
       riscv64-linux = import ./bootstrap-files/riscv64-unknown-linux-gnu.nix;
diff --git a/nixpkgs/pkgs/tools/X11/xssstate/default.nix b/nixpkgs/pkgs/tools/X11/xssstate/default.nix
index a1ce545a5f13..53fd1138c29d 100644
--- a/nixpkgs/pkgs/tools/X11/xssstate/default.nix
+++ b/nixpkgs/pkgs/tools/X11/xssstate/default.nix
@@ -4,29 +4,31 @@
 , libX11
 , libXScrnSaver
 }:
-stdenv.mkDerivation rec {
+stdenv.mkDerivation (finalAttrs: {
   pname = "xssstate";
-  #
-  # Use the date of the last commit, since there were bug fixes after the 1.1
-  # release.
-  #
-  version = "unstable-2022-09-24";
+  version = "1.1-unstable-2022-09-24";
+
   src = fetchgit {
     url = "https://git.suckless.org/xssstate/";
     rev = "5d8e9b49ce2970f786f1e5aa12bbaae83900453f";
     hash = "sha256-Aor12tU1I/qNZCdBhZcvNK1FWFh0HYK8CEI29X5yoeA=";
   };
 
-  makeFlags = [ "VERSION=${version}" ];
-
-  installFlags = [ "PREFIX=$(out)" ];
+  buildInputs = [
+    libX11
+    libXScrnSaver
+  ];
 
-  buildInputs = [ libX11 libXScrnSaver ];
+  makeFlags = [
+    "PREFIX=${placeholder "out"}"
+    "VERSION=${finalAttrs.version}"
+  ];
 
   meta = with lib; {
     description = "A simple tool to retrieve the X screensaver state";
     license = licenses.mit;
     maintainers = with maintainers; [ onemoresuza ];
     platforms = platforms.linux;
+    mainProgram = "xssstate";
   };
-}
+})
diff --git a/nixpkgs/pkgs/tools/admin/syft/default.nix b/nixpkgs/pkgs/tools/admin/syft/default.nix
index 3f6567b09f0c..c596c709977c 100644
--- a/nixpkgs/pkgs/tools/admin/syft/default.nix
+++ b/nixpkgs/pkgs/tools/admin/syft/default.nix
@@ -2,13 +2,13 @@
 
 buildGoModule rec {
   pname = "syft";
-  version = "0.92.0";
+  version = "0.93.0";
 
   src = fetchFromGitHub {
     owner = "anchore";
     repo = pname;
     rev = "v${version}";
-    hash = "sha256-YmzizpcAfE4+Rfq5ydQnDQBo4R+pAyudfi+fqD9EZP0=";
+    hash = "sha256-e8d+CK7rRbyHeRHOjK3tGFIBHuosdV4AMetUQar54E4=";
     # populate values that require us to use git. By doing this in postFetch we
     # can delete .git afterwards and maintain better reproducibility of the src.
     leaveDotGit = true;
@@ -22,7 +22,7 @@ buildGoModule rec {
   };
   # hash mismatch with darwin
   proxyVendor = true;
-  vendorHash = "sha256-siOZWhHqNokkYAPwuXQCs4T1yBiEWUTJzhfbH/Z2uBk=";
+  vendorHash = "sha256-BUCe2v80tHAqMBwa6xae3ZOTOok8msM6hFh6d9D4xZA=";
 
   nativeBuildInputs = [ installShellFiles ];
 
diff --git a/nixpkgs/pkgs/tools/archivers/payload-dumper-go/default.nix b/nixpkgs/pkgs/tools/archivers/payload-dumper-go/default.nix
index bb1572e1ceb6..bb1572e1ceb6 100755..100644
--- a/nixpkgs/pkgs/tools/archivers/payload-dumper-go/default.nix
+++ b/nixpkgs/pkgs/tools/archivers/payload-dumper-go/default.nix
diff --git a/nixpkgs/pkgs/tools/filesystems/erofs-utils/default.nix b/nixpkgs/pkgs/tools/filesystems/erofs-utils/default.nix
index d1daee70967f..e25df7288094 100644
--- a/nixpkgs/pkgs/tools/filesystems/erofs-utils/default.nix
+++ b/nixpkgs/pkgs/tools/filesystems/erofs-utils/default.nix
@@ -30,6 +30,7 @@ stdenv.mkDerivation rec {
   ] ++ lib.optional fuseSupport "--enable-fuse";
 
   meta = with lib; {
+    homepage = "https://git.kernel.org/pub/scm/linux/kernel/git/xiang/erofs-utils.git/about/";
     description = "Userspace utilities for linux-erofs file system";
     license = with licenses; [ gpl2Plus ];
     maintainers = with maintainers; [ ehmry nikstur ];
diff --git a/nixpkgs/pkgs/tools/inputmethods/evsieve/default.nix b/nixpkgs/pkgs/tools/inputmethods/evsieve/default.nix
new file mode 100644
index 000000000000..4497448cad12
--- /dev/null
+++ b/nixpkgs/pkgs/tools/inputmethods/evsieve/default.nix
@@ -0,0 +1,31 @@
+{ lib
+, fetchFromGitHub
+, rustPlatform
+, libevdev
+}:
+
+rustPlatform.buildRustPackage rec {
+  pname = "evsieve";
+  version = "1.3.1";
+
+  src = fetchFromGitHub {
+    owner = "KarsMulder";
+    repo = "evsieve";
+    rev = "v${version}";
+    hash = "sha256-R/y3iyKGE4dzAyNnDwrMCr8JFshYJwNcgHQ8UbtuRj8=";
+  };
+
+  cargoHash = "sha256-jkm+mAHejCBZFalUbJNaIxtIl2kwnlPR2wsaYlcfSz8=";
+
+  buildInputs = [ libevdev ];
+
+  doCheck = false; # unit tests create uinput devices
+
+  meta = with lib; {
+    description = "A utility for mapping events from Linux event devices";
+    homepage = "https://github.com/KarsMulder/evsieve";
+    license = licenses.gpl2Plus;
+    maintainers = with maintainers; [ tsowell ];
+    platforms = platforms.linux;
+  };
+}
diff --git a/nixpkgs/pkgs/tools/misc/ckb-next/default.nix b/nixpkgs/pkgs/tools/misc/ckb-next/default.nix
index f9309ecf81dd..549cb543af19 100644
--- a/nixpkgs/pkgs/tools/misc/ckb-next/default.nix
+++ b/nixpkgs/pkgs/tools/misc/ckb-next/default.nix
@@ -1,17 +1,17 @@
-{ lib, mkDerivation, fetchFromGitHub, substituteAll, udev, stdenv
+{ lib, wrapQtAppsHook, fetchFromGitHub, substituteAll, udev, stdenv
 , pkg-config, qtbase, cmake, zlib, kmod, libXdmcp, qttools, qtx11extras, libdbusmenu
-, withPulseaudio ? stdenv.isLinux, libpulseaudio
+, withPulseaudio ? stdenv.isLinux, libpulseaudio, quazip
 }:
 
-mkDerivation rec {
-  version = "0.5.0";
+stdenv.mkDerivation rec {
+  version = "0.6.0";
   pname = "ckb-next";
 
   src = fetchFromGitHub {
     owner = "ckb-next";
     repo = "ckb-next";
     rev = "v${version}";
-    sha256 = "sha256-yR1myagAqavAR/7lPdufcrJpPmXW7r4N4pxTMF6NbuE=";
+    hash = "sha256-G0cvET3wMIi4FlBmaTkdTyYtcdVGzK4X0C2HYZr43eg=";
   };
 
   buildInputs = [
@@ -22,9 +22,11 @@ mkDerivation rec {
     qttools
     qtx11extras
     libdbusmenu
+    quazip
   ] ++ lib.optional withPulseaudio libpulseaudio;
 
   nativeBuildInputs = [
+    wrapQtAppsHook
     pkg-config
     cmake
   ];
diff --git a/nixpkgs/pkgs/tools/misc/codebraid/default.nix b/nixpkgs/pkgs/tools/misc/codebraid/default.nix
index 0ecde80c238d..f4d8fa4940f0 100644
--- a/nixpkgs/pkgs/tools/misc/codebraid/default.nix
+++ b/nixpkgs/pkgs/tools/misc/codebraid/default.nix
@@ -2,15 +2,17 @@
 
 python3Packages.buildPythonApplication rec {
   pname = "codebraid";
-  version = "0.5.0-unstable-2020-08-14";
+  version = "0.11.0";
+  format = "pyproject";
 
   src = fetchFromGitHub {
     owner = "gpoore";
     repo = pname;
-    rev = "526a223c4fc32c37d6c5c9133524dfa0e1811ca4";
-    sha256 = "0qkqaj49k584qzgx9jlsf5vlv4lq7x403s1kig8v87i0kgh55p56";
+    rev = "v${version}";
+    hash = "sha256-E9vzGK9ZEVwF+UBpSkdM+hm6vINen/A+LgnnPpc77QQ=";
   };
 
+  nativeBuildInputs = with python3Packages; [ setuptools ];
   propagatedBuildInputs = with python3Packages; [ bespon ];
   # unfortunately upstream doesn't contain tests
   checkPhase = ''
diff --git a/nixpkgs/pkgs/tools/misc/esphome/default.nix b/nixpkgs/pkgs/tools/misc/esphome/default.nix
index b791cac21bd4..de7b7d5d03ef 100644
--- a/nixpkgs/pkgs/tools/misc/esphome/default.nix
+++ b/nixpkgs/pkgs/tools/misc/esphome/default.nix
@@ -16,14 +16,14 @@ let
 in
 python.pkgs.buildPythonApplication rec {
   pname = "esphome";
-  version = "2023.9.3";
+  version = "2023.10.1";
   format = "setuptools";
 
   src = fetchFromGitHub {
     owner = pname;
     repo = pname;
     rev = "refs/tags/${version}";
-    hash = "sha256-SyXEiGh1/s9EJ0UPYC8R04JUYkCPhCtNUcGvVCycKGM=";
+    hash = "sha256-XKZYnZYXETv0UXrKtjQvDXyv8lwqfO19jc5Fs3KMhEY=";
   };
 
   postPatch = ''
diff --git a/nixpkgs/pkgs/tools/misc/fd/default.nix b/nixpkgs/pkgs/tools/misc/fd/default.nix
index 23e00e00363c..84da1044f1a4 100644
--- a/nixpkgs/pkgs/tools/misc/fd/default.nix
+++ b/nixpkgs/pkgs/tools/misc/fd/default.nix
@@ -2,16 +2,16 @@
 
 rustPlatform.buildRustPackage rec {
   pname = "fd";
-  version = "8.7.0";
+  version = "8.7.1";
 
   src = fetchFromGitHub {
     owner = "sharkdp";
     repo = "fd";
     rev = "v${version}";
-    hash = "sha256-y7IrwMLQnvz1PeKt8BE9hbEBwQBiUXM4geYbiTjMymw=";
+    hash = "sha256-euQiMVPKE1/YG04VKMFUA27OtoGENNhqeE0iiF/X7uc=";
   };
 
-  cargoHash = "sha256-AstE8KGICgPhqRKlJecrE9iPUUWaOvca6ocWf85IzNo=";
+  cargoHash = "sha256-doeZTjFPXmxIPYX3IBtetePoNkIHnl6oPJFtXD1tgZY=";
 
   nativeBuildInputs = [ installShellFiles ];
 
diff --git a/nixpkgs/pkgs/tools/misc/lazydocker/default.nix b/nixpkgs/pkgs/tools/misc/lazydocker/default.nix
index 1fdb0ef0d44b..353402658db9 100644
--- a/nixpkgs/pkgs/tools/misc/lazydocker/default.nix
+++ b/nixpkgs/pkgs/tools/misc/lazydocker/default.nix
@@ -2,13 +2,13 @@
 
 buildGoModule rec {
   pname = "lazydocker";
-  version = "0.23.0";
+  version = "0.23.1";
 
   src = fetchFromGitHub {
     owner = "jesseduffield";
     repo = "lazydocker";
     rev = "v${version}";
-    sha256 = "sha256-BxIv0HCdrR9U9mmJnBdQqiUf/vbK+XEnL8ALPkuap0M=";
+    sha256 = "sha256-nW3eaSisXLqoWZ+5YLLCfC1k4lTXWd5ZqY2xTM/I0PY=";
   };
 
   vendorHash = null;
diff --git a/nixpkgs/pkgs/tools/misc/starfetch/default.nix b/nixpkgs/pkgs/tools/misc/starfetch/default.nix
index ba6309c97ecb..ba6309c97ecb 100755..100644
--- a/nixpkgs/pkgs/tools/misc/starfetch/default.nix
+++ b/nixpkgs/pkgs/tools/misc/starfetch/default.nix
diff --git a/nixpkgs/pkgs/tools/misc/szyszka/default.nix b/nixpkgs/pkgs/tools/misc/szyszka/default.nix
index 58d839acf078..58d839acf078 100755..100644
--- a/nixpkgs/pkgs/tools/misc/szyszka/default.nix
+++ b/nixpkgs/pkgs/tools/misc/szyszka/default.nix
diff --git a/nixpkgs/pkgs/tools/misc/timer/default.nix b/nixpkgs/pkgs/tools/misc/timer/default.nix
index 29e087c86581..962ad1a6dd69 100644
--- a/nixpkgs/pkgs/tools/misc/timer/default.nix
+++ b/nixpkgs/pkgs/tools/misc/timer/default.nix
@@ -2,16 +2,16 @@
 
 buildGoModule rec {
   pname = "timer";
-  version = "1.3.0";
+  version = "1.4.1";
 
   src = fetchFromGitHub {
     owner = "caarlos0";
     repo = "timer";
     rev = "v${version}";
-    hash = "sha256-9p/L3Hj3VqlNiyY3lfUAhCjwTl1iSTegWxaVEGB4qHM=";
+    hash = "sha256-8BVzijAXsJ8Q8BhDmhzFbEQ23fUEBdmbUsCPxfpXyBA=";
   };
 
-  vendorHash = "sha256-j7Xik0te6GdjfhXHT7DRf+MwM+aKjfgTGvroxnlD3MM=";
+  vendorHash = "sha256-1n5vZKlOWoB2SFdDdv+pPWLybzCIJG/wdBYqLMatjNA=";
 
   ldflags = [ "-s" "-w" "-X main.version=${version}" ];
 
diff --git a/nixpkgs/pkgs/tools/misc/topgrade/default.nix b/nixpkgs/pkgs/tools/misc/topgrade/default.nix
index f900eafaacd1..757cb69cbb0b 100644
--- a/nixpkgs/pkgs/tools/misc/topgrade/default.nix
+++ b/nixpkgs/pkgs/tools/misc/topgrade/default.nix
@@ -10,16 +10,16 @@
 
 rustPlatform.buildRustPackage rec {
   pname = "topgrade";
-  version = "12.0.2";
+  version = "13.0.0";
 
   src = fetchFromGitHub {
     owner = "topgrade-rs";
     repo = "topgrade";
     rev = "v${version}";
-    hash = "sha256-PfrtTegJULzPAmKUk/6P9rD+ttPJOhaf2505og64C0Y=";
+    hash = "sha256-BuYwLD8HlmFjCpR8043GhrYK3XWffeqEaeEDqWhxZVI=";
   };
 
-  cargoHash = "sha256-S6jSI/KuHocYD2dhg3o1NSyA8Q04Xo215TWl8Y1C7g8=";
+  cargoHash = "sha256-+kSvA9AC0peXeFLVjenATRfnIS9qaOr/f1ozPbifiPI=";
 
   nativeBuildInputs = [
     installShellFiles
diff --git a/nixpkgs/pkgs/tools/networking/ddclient/default.nix b/nixpkgs/pkgs/tools/networking/ddclient/default.nix
new file mode 100644
index 000000000000..6477c5b185c0
--- /dev/null
+++ b/nixpkgs/pkgs/tools/networking/ddclient/default.nix
@@ -0,0 +1,53 @@
+{ lib, fetchFromGitHub, perlPackages, autoreconfHook, iproute2, perl, curl }:
+
+let
+  myPerl = perl.withPackages (ps: [ ps.JSONPP ]);
+in
+perlPackages.buildPerlPackage rec {
+  pname = "ddclient";
+  version = "3.11.0_1";
+
+  outputs = [ "out" ];
+
+  src = fetchFromGitHub {
+    owner = "ddclient";
+    repo = "ddclient";
+    rev = "v${version}";
+    sha256 = "sha256-pl1kbzY5nUIvx1QiDdL9TP4vKtQnnv3RWklE4gbxXCw=";
+  };
+
+  postPatch = ''
+    touch Makefile.PL
+  '';
+
+  nativeBuildInputs = [ autoreconfHook ];
+
+  buildInputs = [ curl myPerl ];
+
+  # Prevent ddclient from picking up build time perl which is implicitly added
+  # by buildPerlPackage.
+  configureFlags = [
+    "--with-perl=${lib.getExe myPerl}"
+  ];
+
+  installPhase = ''
+    runHook preInstall
+
+    install -Dm755 ddclient $out/bin/ddclient
+    install -Dm644 -t $out/share/doc/ddclient COP* README.* ChangeLog.md
+
+    runHook postInstall
+  '';
+
+  # TODO: run upstream tests
+  doCheck = false;
+
+  meta = with lib; {
+    description = "Client for updating dynamic DNS service entries";
+    homepage = "https://ddclient.net/";
+    license = licenses.gpl2Plus;
+    platforms = platforms.linux;
+    maintainers = with maintainers; [ bjornfor ];
+    mainProgram = "ddclient";
+  };
+}
diff --git a/nixpkgs/pkgs/tools/networking/globalping-cli/default.nix b/nixpkgs/pkgs/tools/networking/globalping-cli/default.nix
index bc07f20a5b11..c88688bca71d 100644
--- a/nixpkgs/pkgs/tools/networking/globalping-cli/default.nix
+++ b/nixpkgs/pkgs/tools/networking/globalping-cli/default.nix
@@ -2,13 +2,13 @@
 
 buildGoModule rec {
   pname = "globalping-cli";
-  version = "1.1.0";
+  version = "1.1.5";
 
   src = fetchFromGitHub {
     owner = "jsdelivr";
     repo = pname;
     rev = "v${version}";
-    hash = "sha256-UY+SAmkE8h/K92Em5iikcMiNixkqnDVkhlrKVq1ZkVM=";
+    hash = "sha256-k89tqQpGvX0WiYqEwPj+tDViUKDjLR5MrkA0CQI/A+o=";
   };
 
   vendorHash = "sha256-fUB7WIEAPBot8A2f7WQ5wUDtCrOydZd4nd4qDuy1vzg=";
diff --git a/nixpkgs/pkgs/tools/networking/hysteria/default.nix b/nixpkgs/pkgs/tools/networking/hysteria/default.nix
index 9885066397b6..80b12b6d6d67 100644
--- a/nixpkgs/pkgs/tools/networking/hysteria/default.nix
+++ b/nixpkgs/pkgs/tools/networking/hysteria/default.nix
@@ -4,16 +4,16 @@
 }:
 buildGo121Module rec {
   pname = "hysteria";
-  version = "2.0.3";
+  version = "2.1.1";
 
   src = fetchFromGitHub {
     owner = "apernet";
     repo = pname;
     rev = "app/v${version}";
-    hash = "sha256-0ekw92T9yWrKu5MxSssOCXlUFubiVLoH6ZLEMDFkcis=";
+    hash = "sha256-CvhDOtXyGxnTy8m7qN5lmQxOxwkExfW+1ZT3LrLjsmo=";
   };
 
-  vendorHash = "sha256-Hf+Jx/z+hJ6jqWLJHGK7umNgNzNKYgQtCdAosdrqvPg=";
+  vendorHash = "sha256-Io7EN+Cza7drMLB9JF4nRDxq+eVxW5sYj45WWvXtDsY=";
   proxyVendor = true;
 
   ldflags = [
diff --git a/nixpkgs/pkgs/tools/networking/ipfetch/default.nix b/nixpkgs/pkgs/tools/networking/ipfetch/default.nix
index b9b675366e56..b9b675366e56 100755..100644
--- a/nixpkgs/pkgs/tools/networking/ipfetch/default.nix
+++ b/nixpkgs/pkgs/tools/networking/ipfetch/default.nix
diff --git a/nixpkgs/pkgs/tools/networking/requestly/default.nix b/nixpkgs/pkgs/tools/networking/requestly/default.nix
index 33d03140c398..3a4128c0806d 100644
--- a/nixpkgs/pkgs/tools/networking/requestly/default.nix
+++ b/nixpkgs/pkgs/tools/networking/requestly/default.nix
@@ -5,11 +5,11 @@
 
 let
   pname = "requestly";
-  version = "1.5.6";
+  version = "1.5.12";
 
   src = fetchurl {
     url = "https://github.com/requestly/requestly-desktop-app/releases/download/v${version}/Requestly-${version}.AppImage";
-    hash = "sha256-Yb90OGIIvExfNPoJPmuZSvtU5OQVuGqh4EmyKltE+is=";
+    hash = "sha256-HM3+j9E67J1bAklnDtSN5/rOK9Wn7N7h+qlPKR/E8Ns=";
   };
 
   appimageContents = appimageTools.extractType2 { inherit pname version src; };
diff --git a/nixpkgs/pkgs/tools/networking/tgt/default.nix b/nixpkgs/pkgs/tools/networking/tgt/default.nix
index e47478b9206b..4030e3d14ec1 100644
--- a/nixpkgs/pkgs/tools/networking/tgt/default.nix
+++ b/nixpkgs/pkgs/tools/networking/tgt/default.nix
@@ -4,13 +4,13 @@
 
 stdenv.mkDerivation rec {
   pname = "tgt";
-  version = "1.0.87";
+  version = "1.0.88";
 
   src = fetchFromGitHub {
     owner = "fujita";
     repo = pname;
     rev = "v${version}";
-    sha256 = "sha256-nDYNXQJqCtwlm4HTPTMuUbn6FA8JRYEqxbYUAev2R3o=";
+    sha256 = "sha256-tLc+viPufR6P5texDs9lU8wsOTzrjSK0Qz/r4/L8M5k=";
   };
 
   nativeBuildInputs = [ libxslt docbook_xsl makeWrapper ];
diff --git a/nixpkgs/pkgs/tools/networking/voms/default.nix b/nixpkgs/pkgs/tools/networking/voms/default.nix
index a16648b9a833..cafc812032b7 100644
--- a/nixpkgs/pkgs/tools/networking/voms/default.nix
+++ b/nixpkgs/pkgs/tools/networking/voms/default.nix
@@ -13,7 +13,8 @@
 , zlib
   # Configuration overridable with .override
   # If not null, the builder will
-  # move "$out/etc" to "$out/etc.orig" and symlink "$out/etc" to externalEtc.
+  # create a new output "etc", move "$out/etc" to "$etc/etc"
+  # and symlink "$out/etc" to externalEtc.
 , externalEtc ? "/etc"
 }:
 
@@ -46,7 +47,8 @@ stdenv.mkDerivation rec{
     zlib
   ];
 
-  outputs = [ "bin" "out" "dev" "man" ];
+  outputs = [ "bin" "out" "dev" "man" ]
+    ++ lib.optional (externalEtc != null) "etc";
 
   preAutoreconf = ''
     mkdir -p aux src/autogen
@@ -65,13 +67,12 @@ stdenv.mkDerivation rec{
 
   configureFlags = [
     "--with-gsoap-wsdl2h=${gsoap}/bin/wsdl2h"
+    "--sysconfdir=${placeholder "out"}/etc"
   ];
 
-  postFixup = ''
-    ${lib.optionalString (externalEtc != null) ''
-      mv "$out"/etc{,.orig}
-      ln -s ${lib.escapeShellArg externalEtc} "$out/etc"
-    ''}
+  postFixup = lib.optionalString (externalEtc != null) ''
+    moveToOutput etc "$etc"
+    ln -s ${lib.escapeShellArg externalEtc} "$out/etc"
   '';
 
   meta = with lib; {
diff --git a/nixpkgs/pkgs/tools/networking/xrootd/default.nix b/nixpkgs/pkgs/tools/networking/xrootd/default.nix
index 47496173642c..e32139fdfceb 100644
--- a/nixpkgs/pkgs/tools/networking/xrootd/default.nix
+++ b/nixpkgs/pkgs/tools/networking/xrootd/default.nix
@@ -39,7 +39,8 @@ stdenv.mkDerivation (finalAttrs: {
     hash = "sha256-SLmxv8opN7z4V07S9kLGo8HG7Ql62iZQLtf3zGemwA8=";
   };
 
-  outputs = [ "bin" "out" "dev" "man" ];
+  outputs = [ "bin" "out" "dev" "man" ]
+  ++ lib.optional (externalEtc != null) "etc";
 
   passthru.fetchxrd = callPackage ./fetchxrd.nix { xrootd = finalAttrs.finalPackage; };
   passthru.tests =
@@ -118,7 +119,7 @@ stdenv.mkDerivation (finalAttrs: {
       wrapProgram "$FILE" "''${makeWrapperArgs[@]}"
     done < <(find "$bin/bin" -mindepth 1 -maxdepth 1 -type f,l -perm -a+x)
   '' + lib.optionalString (externalEtc != null) ''
-    mv "$out"/etc{,.orig}
+    moveToOutput etc "$etc"
     ln -s ${lib.escapeShellArg externalEtc} "$out/etc"
   '';
 
diff --git a/nixpkgs/pkgs/tools/package-management/zkg/default.nix b/nixpkgs/pkgs/tools/package-management/zkg/default.nix
deleted file mode 100644
index 9d6700469722..000000000000
--- a/nixpkgs/pkgs/tools/package-management/zkg/default.nix
+++ /dev/null
@@ -1,42 +0,0 @@
-{ lib
-, python3
-, fetchFromGitHub
-, pkgs
-}:
-
-python3.pkgs.buildPythonApplication rec {
-  pname = "zkg";
-  version = "2.14.0";
-  format = "setuptools";
-
-  src = fetchFromGitHub {
-    owner = "zeek";
-    repo = "package-manager";
-    rev = "refs/tags/v${version}";
-    hash = "sha256-HdOzxSU3XWz1ZH96woDWrHzKbpJW3/IKkpc2tGfyi9o=";
-  };
-
-  propagatedBuildInputs = with python3.pkgs; [
-    btest
-    gitpython
-    semantic-version
-    sphinx
-    sphinx-rtd-theme
-    pkgs.bash
-  ];
-
-  # No tests available
-  doCheck = false;
-
-  pythonImportsCheck = [
-    "zeekpkg"
-  ];
-
-  meta = with lib; {
-    description = "Package manager for Zeek";
-    homepage = "https://github.com/zeek/package-manager";
-    changelog = "https://github.com/zeek/package-manager/blob/${version}/CHANGES";
-    license = licenses.ncsa;
-    maintainers = with maintainers; [ fab ];
-  };
-}
diff --git a/nixpkgs/pkgs/tools/security/nuclei/default.nix b/nixpkgs/pkgs/tools/security/nuclei/default.nix
index 1f6dd8baeeb1..ae6e1d78f6fa 100644
--- a/nixpkgs/pkgs/tools/security/nuclei/default.nix
+++ b/nixpkgs/pkgs/tools/security/nuclei/default.nix
@@ -5,18 +5,17 @@
 
 buildGoModule rec {
   pname = "nuclei";
-  version = "2.9.15";
+  version = "3.0.1";
 
   src = fetchFromGitHub {
     owner = "projectdiscovery";
     repo = pname;
     rev = "refs/tags/v${version}";
-    hash = "sha256-/7013cf9nnDiKqcwFOYZUF1D+wkQKXPBcwz3YhpBUK0=";
+    hash = "sha256-5Z40wc8ihN2UR3DyMCaD0MOKpgbUQX0OJMyZw2gVNYM=";
   };
 
-  vendorHash = "sha256-b5CY66c2vfGaqlFENw2lnK47Cf2+buh/LtbJyPSAbOA=";
+  vendorHash = "sha256-CaeYAw7QU/KySFDSkUr4oHrG3wyPHxty3KCZ6zlPqIk=";
 
-  modRoot = "./v2";
   subPackages = [
     "cmd/nuclei/"
   ];
diff --git a/nixpkgs/pkgs/tools/security/pynitrokey/default.nix b/nixpkgs/pkgs/tools/security/pynitrokey/default.nix
index 9c36ceb3c841..690d566c476d 100644
--- a/nixpkgs/pkgs/tools/security/pynitrokey/default.nix
+++ b/nixpkgs/pkgs/tools/security/pynitrokey/default.nix
@@ -10,12 +10,12 @@ with python3Packages;
 
 buildPythonApplication rec {
   pname = "pynitrokey";
-  version = "0.4.39";
+  version = "0.4.40";
   format = "pyproject";
 
   src = fetchPypi {
     inherit pname version;
-    hash = "sha256-KXYHeWwV9Tw1ZpO/vASHjDnceeb+1K0yIUohb7EcRAI=";
+    hash = "sha256-Hu+8UooDzv4GhkWt0sCckQQyHjWn4V/zt2ADlVCoHmk=";
   };
 
   propagatedBuildInputs = [
diff --git a/nixpkgs/pkgs/tools/security/rekor/default.nix b/nixpkgs/pkgs/tools/security/rekor/default.nix
index 2820f473c11b..c27416e29d2e 100644
--- a/nixpkgs/pkgs/tools/security/rekor/default.nix
+++ b/nixpkgs/pkgs/tools/security/rekor/default.nix
@@ -4,13 +4,13 @@ let
   generic = { pname, packageToBuild, description }:
     buildGoModule rec {
       inherit pname;
-      version = "1.2.2";
+      version = "1.3.2";
 
       src = fetchFromGitHub {
         owner = "sigstore";
         repo = "rekor";
         rev = "v${version}";
-        hash = "sha256-U7KxkPYVAy3/olXsEgPMX/kzg0KvYMovLO4LWw8guE4=";
+        hash = "sha256-QiK+ixVURf5Fsx9YPgzYCuCy1wYjxTUXGVr4FIn41Xc=";
         # populate values that require us to use git. By doing this in postFetch we
         # can delete .git afterwards and maintain better reproducibility of the src.
         leaveDotGit = true;
@@ -23,7 +23,7 @@ let
         '';
       };
 
-      vendorHash = "sha256-hZyoVlNrPKE6ub94jVEOLGvxWoXKxFYcsEZyRrZuNkQ=";
+      vendorHash = "sha256-0379IX5W51Z48CffK1F2ZCPGLUq0g8lZXIQqaupC5io=";
 
       nativeBuildInputs = [ installShellFiles ];
 
diff --git a/nixpkgs/pkgs/tools/security/scrypt/default.nix b/nixpkgs/pkgs/tools/security/scrypt/default.nix
index aad2873d4aca..d2b8228f6511 100644
--- a/nixpkgs/pkgs/tools/security/scrypt/default.nix
+++ b/nixpkgs/pkgs/tools/security/scrypt/default.nix
@@ -8,11 +8,11 @@
 
 stdenv.mkDerivation rec {
   pname = "scrypt";
-  version = "1.3.1";
+  version = "1.3.2";
 
   src = fetchurl {
     url = "https://www.tarsnap.com/scrypt/${pname}-${version}.tgz";
-    sha256 = "1hnl0r6pmyxiy4dmafmqk1db7wpc0x9rqpzqcwr9d2cmghcj6byz";
+    sha256 = "sha256-1jLBGTQgrG+uv5SC5l4z06VmTszWQ7CaUJ0h0cHym+I=";
   };
 
   outputs = [ "out" "lib" "dev" ];
diff --git a/nixpkgs/pkgs/tools/security/sequoia-sqop/default.nix b/nixpkgs/pkgs/tools/security/sequoia-sqop/default.nix
index f4cae90b546b..fdefbdea9e50 100644
--- a/nixpkgs/pkgs/tools/security/sequoia-sqop/default.nix
+++ b/nixpkgs/pkgs/tools/security/sequoia-sqop/default.nix
@@ -9,7 +9,7 @@
 
 rustPlatform.buildRustPackage rec {
   pname = "sequoia-sqop";
-  version = "0.28.0";
+  version = "0.30.0";
 
   src = fetchFromGitLab {
     owner = "sequoia-pgp";
@@ -17,10 +17,10 @@ rustPlatform.buildRustPackage rec {
     # generated etc
     repo = "sequoia-sop";
     rev = "v${version}";
-    hash = "sha256-4A0eZMXzFtojRD5cXQQUVoS32sQ2lWtFll+q6yhnwG4=";
+    hash = "sha256-2fRlHkT2jhUp1dIqKe8r7ktSbgudCmzuiiyF0WcbYIE=";
   };
 
-  cargoHash = "sha256-gH5WM+PmciViD+eFVlp8tzdc0KdYy1WZLQi92UEWVG4=";
+  cargoHash = "sha256-/LLW0AHCgqi2pAOkhZXNGlmNF/+u0TmSstd/B6mDr6M=";
 
   nativeBuildInputs = [
     pkg-config
diff --git a/nixpkgs/pkgs/tools/security/uncover/default.nix b/nixpkgs/pkgs/tools/security/uncover/default.nix
index 1ea2f4144780..f0ee8aa23757 100644
--- a/nixpkgs/pkgs/tools/security/uncover/default.nix
+++ b/nixpkgs/pkgs/tools/security/uncover/default.nix
@@ -5,16 +5,16 @@
 
 buildGoModule rec {
   pname = "uncover";
-  version = "1.0.6";
+  version = "1.0.7";
 
   src = fetchFromGitHub {
     owner = "projectdiscovery";
     repo = pname;
     rev = "refs/tags/v${version}";
-    hash = "sha256-FJtd73z6Cc56+nBderYncjrac3xRydDeoiJqn8xW29U=";
+    hash = "sha256-CJA+rDLubghaQT+yb0zQY3y8hF0/5ISH9YFvIQHwH2Y=";
   };
 
-  vendorHash = "sha256-mpojOzGedkTthD+fHl9Uhul7tOCN1EGIin+7USoaNmE=";
+  vendorHash = "sha256-A7XPsl27Q5CaQXQUEvNB05B2M3mFGz/yZ4sOnOHxhw8=";
 
   meta = with lib; {
     description = "API wrapper to search for exposed hosts";
diff --git a/nixpkgs/pkgs/tools/system/netdata/default.nix b/nixpkgs/pkgs/tools/system/netdata/default.nix
index 5d9286a1c4d1..8ca73a4faf8c 100644
--- a/nixpkgs/pkgs/tools/system/netdata/default.nix
+++ b/nixpkgs/pkgs/tools/system/netdata/default.nix
@@ -2,13 +2,13 @@
 , CoreFoundation, IOKit, libossp_uuid
 , nixosTests
 , netdata-go-plugins
-, bash, curl, jemalloc, libuv, zlib, libyaml
+, bash, curl, jemalloc, json_c, libuv, zlib, libyaml
 , libcap, libuuid, lm_sensors, protobuf
 , withCups ? false, cups
 , withDBengine ? true, lz4
 , withIpmi ? (!stdenv.isDarwin), freeipmi
 , withNetfilter ? (!stdenv.isDarwin), libmnl, libnetfilter_acct
-, withCloud ? (!stdenv.isDarwin), json_c
+, withCloud ? false
 , withCloudUi ? false
 , withConnPubSub ? false, google-cloud-cpp, grpc
 , withConnPrometheus ? false, snappy
@@ -42,14 +42,13 @@ stdenv.mkDerivation rec {
 
   nativeBuildInputs = [ autoreconfHook pkg-config makeWrapper protobuf ];
   # bash is only used to rewrite shebangs
-  buildInputs = [ bash curl jemalloc libuv zlib libyaml ]
+  buildInputs = [ bash curl jemalloc json_c libuv zlib libyaml ]
     ++ lib.optionals stdenv.isDarwin [ CoreFoundation IOKit libossp_uuid ]
     ++ lib.optionals (!stdenv.isDarwin) [ libcap libuuid ]
     ++ lib.optionals withCups [ cups ]
     ++ lib.optionals withDBengine [ lz4 ]
     ++ lib.optionals withIpmi [ freeipmi ]
     ++ lib.optionals withNetfilter [ libmnl libnetfilter_acct ]
-    ++ lib.optionals withCloud [ json_c ]
     ++ lib.optionals withConnPubSub [ google-cloud-cpp grpc ]
     ++ lib.optionals withConnPrometheus [ snappy ]
     ++ lib.optionals (withCloud || withConnPrometheus) [ protobuf ]
diff --git a/nixpkgs/pkgs/top-level/aliases.nix b/nixpkgs/pkgs/top-level/aliases.nix
index 9d2e755ca144..c1d23ad8fba7 100644
--- a/nixpkgs/pkgs/top-level/aliases.nix
+++ b/nixpkgs/pkgs/top-level/aliases.nix
@@ -92,7 +92,6 @@ mapAliases ({
   bird2 = bird; # Added 2022-02-21
   bitwig-studio1 = throw "bitwig-studio1 has been removed, you can upgrade to 'bitwig-studio'"; # Added 2023-01-03
   bitwig-studio2 = throw "bitwig-studio2 has been removed, you can upgrade to 'bitwig-studio'"; # Added 2023-01-03
-  ddclient = throw "ddclient has been removed on the request of the upstream maintainer because it is unmaintained and has bugs. Please switch to a different software like `inadyn` or `knsupdate`."; # Added 2023-07-04
   bluezFull = throw "'bluezFull' has been renamed to/replaced by 'bluez'"; # Converted to throw 2023-09-10
   boost168 = throw "boost168 has been deprecated in favor of the latest version"; # Added 2023-06-08
   boost169 = throw "boost169 has been deprecated in favor of the latest version"; # Added 2023-06-08
@@ -973,6 +972,7 @@ mapAliases ({
   ### Z ###
 
   zinc = zincsearch; # Added 2023-05-28
+  zkg = throw "'zkg' has been replaced by 'zeek'";
   zq = zed.overrideAttrs (old: { meta = old.meta // { mainProgram = "zq"; }; }); # Added 2023-02-06
 
   ### UNSORTED ###
diff --git a/nixpkgs/pkgs/top-level/all-packages.nix b/nixpkgs/pkgs/top-level/all-packages.nix
index b3be220675c7..bb6c0b24f158 100644
--- a/nixpkgs/pkgs/top-level/all-packages.nix
+++ b/nixpkgs/pkgs/top-level/all-packages.nix
@@ -3267,10 +3267,6 @@ with pkgs;
 
   apitrace = libsForQt5.callPackage ../applications/graphics/apitrace { };
 
-  argagg = callPackage ../development/libraries/argagg { };
-
-  argtable = callPackage ../development/libraries/argtable { };
-
   arguments = callPackage ../development/libraries/arguments { };
 
   argus = callPackage ../tools/networking/argus { };
@@ -6977,6 +6973,8 @@ with pkgs;
 
   evdevremapkeys = callPackage ../tools/inputmethods/evdevremapkeys { };
 
+  evsieve = callPackage ../tools/inputmethods/evsieve { };
+
   eyedropper = callPackage ../applications/graphics/eyedropper { };
 
   persistent-evdev = python3Packages.callPackage ../servers/persistent-evdev { };
@@ -7425,6 +7423,8 @@ with pkgs;
 
   ddcutil = callPackage ../tools/misc/ddcutil { };
 
+  ddclient = callPackage ../tools/networking/ddclient { };
+
   dd_rescue = callPackage ../tools/system/dd_rescue { };
 
   ddh = callPackage ../tools/system/ddh { };
@@ -10259,6 +10259,10 @@ with pkgs;
     inherit (darwin.apple_sdk.frameworks) CoreFoundation IOKit;
     protobuf = protobuf3_21;
   };
+  netdataCloud = netdata.override {
+    withCloud = !stdenv.isDarwin;
+    withCloudUi = true;
+  };
   # Exposed here so the bots can auto-upgrade it
   netdata-go-plugins = callPackage ../tools/system/netdata/go.d.plugin.nix { };
 
@@ -12660,7 +12664,7 @@ with pkgs;
 
   rewrk = callPackage ../tools/networking/rewrk { };
 
-  inherit (callPackage ../tools/security/rekor { })
+  inherit (callPackage ../tools/security/rekor { buildGoModule = buildGo121Module; })
     rekor-cli
     rekor-server;
 
@@ -13830,6 +13834,7 @@ with pkgs;
   tewisay = callPackage ../tools/misc/tewisay { };
 
   texmacs = libsForQt5.callPackage ../applications/editors/texmacs {
+    stdenv = if stdenv.isDarwin then darwin.apple_sdk_11_0.stdenv else stdenv;
     tex = texlive.combined.scheme-small;
     extraFonts = true;
   };
@@ -20842,6 +20847,8 @@ with pkgs;
 
   certbot-full = certbot.withPlugins (cp: with cp; [
     certbot-dns-cloudflare
+    certbot-dns-google
+    certbot-dns-ovh
     certbot-dns-rfc2136
     certbot-dns-route53
   ]);
@@ -24745,6 +24752,8 @@ with pkgs;
 
   readline82 = callPackage ../development/libraries/readline/8.2.nix { };
 
+  readmdict = with python3Packages; toPythonApplication readmdict;
+
   readosm = callPackage ../development/libraries/readosm { };
 
   recastnavigation = callPackage ../development/libraries/recastnavigation { };
@@ -28322,7 +28331,9 @@ with pkgs;
     checkMeta = callPackage ../stdenv/generic/check-meta.nix { };
   });
   minimal-bootstrap-sources = callPackage ../os-specific/linux/minimal-bootstrap/stage0-posix/bootstrap-sources.nix { };
-  make-minimal-bootstrap-sources = callPackage ../os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix { };
+  make-minimal-bootstrap-sources = callPackage ../os-specific/linux/minimal-bootstrap/stage0-posix/make-bootstrap-sources.nix {
+    inherit (stdenv) hostPlatform;
+  };
 
   mingetty = callPackage ../os-specific/linux/mingetty { };
 
@@ -28447,7 +28458,9 @@ with pkgs;
 
   golint = callPackage ../development/tools/golint { };
 
-  golangci-lint = callPackage ../development/tools/golangci-lint { };
+  golangci-lint = callPackage ../development/tools/golangci-lint {
+    buildGoModule = buildGo121Module;
+  };
 
   golangci-lint-langserver = callPackage ../development/tools/golangci-lint-langserver { };
 
@@ -29755,7 +29768,9 @@ with pkgs;
 
   nuclear = callPackage ../applications/audio/nuclear { };
 
-  nuclei = callPackage ../tools/security/nuclei { };
+  nuclei = callPackage ../tools/security/nuclei {
+    buildGoModule = buildGo121Module;
+  };
 
   nullmailer = callPackage ../servers/mail/nullmailer {
     stdenv = gccStdenv;
@@ -34464,7 +34479,7 @@ with pkgs;
   wrapOBS = callPackage ../applications/video/obs-studio/wrapper.nix { };
 
   obsidian = callPackage ../applications/misc/obsidian {
-    electron = electron_24;
+    electron = electron_25;
   };
 
   octoprint = callPackage ../applications/misc/octoprint { };
@@ -35381,8 +35396,6 @@ with pkgs;
 
   tart = callPackage ../applications/virtualization/tart { };
 
-  tecoc = callPackage ../applications/editors/tecoc { };
-
   viber = callPackage ../applications/networking/instant-messengers/viber { };
 
   wavebox = libsForQt5.callPackage ../applications/networking/instant-messengers/wavebox { };
@@ -41498,8 +41511,6 @@ with pkgs;
 
   xbps = callPackage ../tools/package-management/xbps { };
 
-  zkg = callPackage ../tools/package-management/zkg { };
-
   xcftools = callPackage ../tools/graphics/xcftools { };
 
   xhyve = callPackage ../applications/virtualization/xhyve {
diff --git a/nixpkgs/pkgs/top-level/perl-packages.nix b/nixpkgs/pkgs/top-level/perl-packages.nix
index c51524a23ad6..c991ef0bb6ec 100644
--- a/nixpkgs/pkgs/top-level/perl-packages.nix
+++ b/nixpkgs/pkgs/top-level/perl-packages.nix
@@ -4954,7 +4954,12 @@ with self; {
       url = "mirror://cpan/authors/id/B/BA/BARTB/Crypt-HSXKPasswd-v3.6.tar.gz";
       hash = "sha256-lZ3MX58BG/ALha0i31ZrerK/XqHTYrDeD7WuKfvEWLM=";
     };
-    buildInputs = [ Clone DateTime FileHomeDir FileShare FileShareDir GetoptLong JSON ListMoreUtils MathRound Readonly TextUnidecode TypeTiny ];
+    nativeBuildInputs = lib.optional stdenv.isDarwin shortenPerlShebang;
+    propagatedBuildInputs = [ Clone DateTime FileHomeDir FileShare FileShareDir GetoptLong JSON ListMoreUtils MathRound Readonly TextUnidecode TypeTiny ];
+    postInstall = lib.optionalString stdenv.isDarwin ''
+      shortenPerlShebang $out/bin/hsxkpasswd
+    '';
+
     meta = {
       description = "A secure memorable password generator";
       homepage = "http://www.bartb.ie/hsxkpasswd";
diff --git a/nixpkgs/pkgs/top-level/python-aliases.nix b/nixpkgs/pkgs/top-level/python-aliases.nix
index 66be4900a11b..4e679de15084 100644
--- a/nixpkgs/pkgs/top-level/python-aliases.nix
+++ b/nixpkgs/pkgs/top-level/python-aliases.nix
@@ -290,6 +290,7 @@ mapAliases ({
   pymc3 = pymc; # added 2022-06-05, module was rename starting with 4.0.0
   pymssql = throw "pymssql has been abandoned upstream."; # added 2020-05-04
   PyMVGLive = pymvglive; # added 2023-02-19
+  pymyq = python-myq; # added 2023-10-20
   pyqt4 = throw "pyqt4 has been removed, because it depended on the long EOL qt4"; # added 2022-06-09
   pyramid_beaker = pyramid-beaker; # added 2023-08-23
   pyramid_chameleon = pyramid-chameleon; # added 2023-08-23
diff --git a/nixpkgs/pkgs/top-level/python-packages.nix b/nixpkgs/pkgs/top-level/python-packages.nix
index 16b5bb4feecd..f96132e53246 100644
--- a/nixpkgs/pkgs/top-level/python-packages.nix
+++ b/nixpkgs/pkgs/top-level/python-packages.nix
@@ -198,6 +198,8 @@ self: super: with self; {
 
   aioecowitt = callPackage ../development/python-modules/aioecowitt { };
 
+  aioelectricitymaps = callPackage ../development/python-modules/aioelectricitymaps { };
+
   aioemonitor = callPackage ../development/python-modules/aioemonitor { };
 
   aioesphomeapi = callPackage ../development/python-modules/aioesphomeapi { };
@@ -1775,6 +1777,8 @@ self: super: with self; {
 
   canopen = callPackage ../development/python-modules/canopen { };
 
+  cantools = callPackage ../development/python-modules/cantools { };
+
   camelot = callPackage ../development/python-modules/camelot { };
 
   capstone = callPackage ../development/python-modules/capstone {
@@ -1876,11 +1880,13 @@ self: super: with self; {
 
   certbot-dns-cloudflare = callPackage ../development/python-modules/certbot-dns-cloudflare { };
 
+  certbot-dns-google = callPackage ../development/python-modules/certbot-dns-google { };
+
   certbot-dns-inwx = callPackage ../development/python-modules/certbot-dns-inwx { };
 
-  certbot-dns-rfc2136 = callPackage ../development/python-modules/certbot-dns-rfc2136 { };
+  certbot-dns-ovh = callPackage ../development/python-modules/certbot-dns-ovh { };
 
-  certbot-dns-google = callPackage ../development/python-modules/certbot-dns-google { };
+  certbot-dns-rfc2136 = callPackage ../development/python-modules/certbot-dns-rfc2136 { };
 
   certbot-dns-route53 = callPackage ../development/python-modules/certbot-dns-route53 { };
 
@@ -10462,7 +10468,7 @@ self: super: with self; {
 
   pymvglive = callPackage ../development/python-modules/pymvglive { };
 
-  pymyq = callPackage ../development/python-modules/pymyq { };
+  python-myq = callPackage ../development/python-modules/python-myq { };
 
   pymysensors = callPackage ../development/python-modules/pymysensors { };
 
@@ -12038,6 +12044,8 @@ self: super: with self; {
 
   readlike = callPackage ../development/python-modules/readlike { };
 
+  readmdict = callPackage ../development/python-modules/readmdict { };
+
   readme = callPackage ../development/python-modules/readme { };
 
   readme_renderer = callPackage ../development/python-modules/readme_renderer { };
@@ -13736,6 +13744,8 @@ self: super: with self; {
 
   textile = callPackage ../development/python-modules/textile { };
 
+  textparser = callPackage ../development/python-modules/textparser { };
+
   textual = callPackage ../development/python-modules/textual { };
 
   textual-universal-directorytree = callPackage ../development/python-modules/textual-universal-directorytree { };