about summary refs log tree commit diff
path: root/nixpkgs/pkgs/applications/science/biology/bowtie2
diff options
context:
space:
mode:
Diffstat (limited to 'nixpkgs/pkgs/applications/science/biology/bowtie2')
-rw-r--r--nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix62
1 files changed, 62 insertions, 0 deletions
diff --git a/nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix b/nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix
new file mode 100644
index 000000000000..dbcecb7ac3fb
--- /dev/null
+++ b/nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix
@@ -0,0 +1,62 @@
+{ lib
+, stdenv
+, fetchFromGitHub
+, cmake
+, perl
+, python3
+, tbb
+, zlib
+, runCommand
+, bowtie2
+}:
+
+stdenv.mkDerivation (finalAttrs: {
+  pname = "bowtie2";
+  version = "2.5.3";
+
+  src = fetchFromGitHub {
+    owner = "BenLangmead";
+    repo = "bowtie2";
+    rev = "refs/tags/v${finalAttrs.version}";
+    fetchSubmodules = true;
+    hash = "sha256-vjJRA9KFfJChxxg2wxBkwsnDw7fx5SNH3JhRXQw+7XA=";
+  };
+
+  # because of this flag, gcc on aarch64 cannot find the Threads
+  # Could NOT find Threads (missing: Threads_FOUND)
+  # TODO: check with other distros and report upstream
+  postPatch = ''
+    substituteInPlace CMakeLists.txt \
+      --replace "-m64" ""
+  '';
+
+  nativeBuildInputs = [ cmake ];
+
+  buildInputs = [ tbb zlib python3 perl ];
+
+  cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];
+
+  # ctest fails because of missing dependencies between tests
+  doCheck = false;
+
+  passthru.tests = {
+    ctest = runCommand "${finalAttrs.pname}-test" { } ''
+      mkdir $out
+      ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
+      ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
+      ${bowtie2}/bin/bowtie2-inspect-s $out/small
+      ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
+      ${bowtie2}/bin/bowtie2-inspect-l $out/large
+    '';
+  };
+
+  meta = with lib; {
+    description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
+    license = licenses.gpl3Plus;
+    homepage = "http://bowtie-bio.sf.net/bowtie2";
+    changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}";
+    maintainers = with maintainers; [ rybern ];
+    platforms = platforms.all;
+    mainProgram = "bowtie2";
+  };
+})