diff options
Diffstat (limited to 'nixpkgs/pkgs/applications/science/biology/bowtie2')
-rw-r--r-- | nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix | 62 |
1 files changed, 62 insertions, 0 deletions
diff --git a/nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix b/nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix new file mode 100644 index 000000000000..dbcecb7ac3fb --- /dev/null +++ b/nixpkgs/pkgs/applications/science/biology/bowtie2/default.nix @@ -0,0 +1,62 @@ +{ lib +, stdenv +, fetchFromGitHub +, cmake +, perl +, python3 +, tbb +, zlib +, runCommand +, bowtie2 +}: + +stdenv.mkDerivation (finalAttrs: { + pname = "bowtie2"; + version = "2.5.3"; + + src = fetchFromGitHub { + owner = "BenLangmead"; + repo = "bowtie2"; + rev = "refs/tags/v${finalAttrs.version}"; + fetchSubmodules = true; + hash = "sha256-vjJRA9KFfJChxxg2wxBkwsnDw7fx5SNH3JhRXQw+7XA="; + }; + + # because of this flag, gcc on aarch64 cannot find the Threads + # Could NOT find Threads (missing: Threads_FOUND) + # TODO: check with other distros and report upstream + postPatch = '' + substituteInPlace CMakeLists.txt \ + --replace "-m64" "" + ''; + + nativeBuildInputs = [ cmake ]; + + buildInputs = [ tbb zlib python3 perl ]; + + cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"]; + + # ctest fails because of missing dependencies between tests + doCheck = false; + + passthru.tests = { + ctest = runCommand "${finalAttrs.pname}-test" { } '' + mkdir $out + ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10 + ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small + ${bowtie2}/bin/bowtie2-inspect-s $out/small + ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large + ${bowtie2}/bin/bowtie2-inspect-l $out/large + ''; + }; + + meta = with lib; { + description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences"; + license = licenses.gpl3Plus; + homepage = "http://bowtie-bio.sf.net/bowtie2"; + changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}"; + maintainers = with maintainers; [ rybern ]; + platforms = platforms.all; + mainProgram = "bowtie2"; + }; +}) |